Homework Help is Here – Start Your Trial Now!
Science
Biology
Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q")   5' UCAACUGCGAAUCUGGAAUAU 3'

Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q")   5' UCAACUGCGAAUCUGGAAUAU 3'

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question

Translate the following RNA sequence by using the genetic below. Start at the beginning of the sequence and don't worry about start and stop codons. Write out the sequence using the single letter code. (This table displays the amino acids in a single-letter code instead of a three-letter code. Each codon is found by matching the first position on the left of the chart, second position at the top, and last position at the right. For example, the codon CAG gives the amino acid "Q")

 

5' UCAACUGCGAAUCUGGAAUAU 3'

The image is a representation of the genetic code table which shows how sequences of nucleotides (codons) correspond to specific amino acids in the process of protein synthesis. **Explanation of the Genetic Code Table:** The table is organized into rows and columns, intersecting to form cells where each cell corresponds to a specific amino acid represented by a one-letter code. The genetic code is read in triplets called codons, each consisting of three nucleotide bases. The table specifies this mapping using combinations of the four nucleotides: U (Uracil), C (Cytosine), A (Adenine), and G (Guanine). - **First Position (1st Column):** - The column on the far left lists the first nucleotide of the codon. - It is divided into four blocks, labeled by the first nucleotide: U, C, A, and G. Each block represents one possible first base. - **Second Position (2nd Row):** - The top row beneath "2nd" indicates the second nucleotide of the codon and is divided into four groups: U, C, A, and G. - Within each block from the first position, this row dictates the sequence variation, creating further subdivisions for the codon's second base. - **Third Position (3rd Column):** - The far-right column, labeled "3rd," represents the third nucleotide of the codon. Each subdivision in this column corresponds to the variations of the third base within each specific first and second base combination. **Amino Acid Representation:** - Inside the table, each combination of the first (1st), second (2nd), and third (3rd) nucleotide positions results in the designation of a specific amino acid or a stop signal (*). The amino acids are represented by their standard one-letter abbreviations, such as F (Phenylalanine), L (Leucine), S (Serine), Y (Tyrosine), etc. - A star (*) symbol represents a stop codon, which signifies the termination of protein synthesis. ### Key Features: - Codons that result in the production of the same amino acid are often grouped together; these are due to the redundancy in the genetic code. - The table makes clear how different nucleotide sequences lead to different outcomes in the process of translation from mRNA to an amino acid chain, eventually forming proteins. This table provides a critical reference for understanding
Transcribed Image Text:The image is a representation of the genetic code table which shows how sequences of nucleotides (codons) correspond to specific amino acids in the process of protein synthesis. **Explanation of the Genetic Code Table:** The table is organized into rows and columns, intersecting to form cells where each cell corresponds to a specific amino acid represented by a one-letter code. The genetic code is read in triplets called codons, each consisting of three nucleotide bases. The table specifies this mapping using combinations of the four nucleotides: U (Uracil), C (Cytosine), A (Adenine), and G (Guanine). - **First Position (1st Column):** - The column on the far left lists the first nucleotide of the codon. - It is divided into four blocks, labeled by the first nucleotide: U, C, A, and G. Each block represents one possible first base. - **Second Position (2nd Row):** - The top row beneath "2nd" indicates the second nucleotide of the codon and is divided into four groups: U, C, A, and G. - Within each block from the first position, this row dictates the sequence variation, creating further subdivisions for the codon's second base. - **Third Position (3rd Column):** - The far-right column, labeled "3rd," represents the third nucleotide of the codon. Each subdivision in this column corresponds to the variations of the third base within each specific first and second base combination. **Amino Acid Representation:** - Inside the table, each combination of the first (1st), second (2nd), and third (3rd) nucleotide positions results in the designation of a specific amino acid or a stop signal (*). The amino acids are represented by their standard one-letter abbreviations, such as F (Phenylalanine), L (Leucine), S (Serine), Y (Tyrosine), etc. - A star (*) symbol represents a stop codon, which signifies the termination of protein synthesis. ### Key Features: - Codons that result in the production of the same amino acid are often grouped together; these are due to the redundancy in the genetic code. - The table makes clear how different nucleotide sequences lead to different outcomes in the process of translation from mRNA to an amino acid chain, eventually forming proteins. This table provides a critical reference for understanding
Expert Solution
Step 1

The proteins are the final end product of a gene that ultimately determine the characteristics of an organism. Proteins are made up of polypeptide chain in which amino acids are bonded together by peptide bonds.

steps

Step by step

Solved in 2 steps with 1 images

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS