What amino acid sequence will be generated, based on the following DNA codon sequence? Did you read this question carefully also? Are you certain? (You may list the three letter abbreviations for the amino acids listed below) DNA Sequence: TAC AAG CCC TAG GCG ATA АТС [a] Table 1. MRNA codons & associated amino acids Second base C G UUU Phe UUC UCU UAU UGU U Тyr UAC Cys UGC UCC Ser UCA UAA Stop UGA Stop A UUA Leu UUG UCG UAG Stop UGG Trp G CUU CCU CAU] His CAC CGU CUC C CUA CGC Leu Pro CCA Arg CGA CAA Gin CUG CCG CAG CGG AUU ACU AAU Asn AAC Thr AAA Lys AAG AGU Ser AGC AUC Ile ACC AUA AGA Arg AGG ACA AUG Met or start ACG GUU GCU GAU GGU Asp GAC U GÚC GCC Ala GCA GGC Val GUA Gly GAA GGA Glu GAG GUG GCG GGG G Cooriaht O Pearson Education. Inc Dublishina as Beniamin Cumminas First base (5' end) Third base (3' end)

Q: What amino acid sequence is encoded by the codon sequence ACGCAGCGCCCGGUC? Use the 3 letter…

A: The amino acids are produced by the help of ribosome in the process of translation. In this process…

Q: Using the following sequence and the amino acid chart, please give the amino acid sequence:…

A: The genetic material in majority of complex higher organisms and various viruses is DNA or…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: Which of the following sequences is most likely to form an a helix?

A: An alpha helix is a sort of secondary structure, which describes how a protein's main chain is…

Q: For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all…

A: A mutation is a known as a change to an organism's DNA sequence. A single nucleotide is altered by…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: For each DNA sequence below, there is a single nucleotide mutation in the DNA sequence. For all…

A: According to the question, the sequence 5 has the mutation highlighted in orange. Also given a…

Q: ginine rine ginine cine Third letter DCAG UCAG UCAG

A: There are 64 possible codon out of which 3 codon do not code for any amino acid.  Thus 61 codon code…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: eseg pL oseg sy non UCC UAU sko C. UAC UGA dos UGG UUA UCA UAA dois dois CGU ne UAG UCG dil CAU CUC…

A: Genetic code The combination of three nucleotides called codon . Each codon codes for an amino acid…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG…

A: In this image the process of transcription is shown where an mRNA is being translated with the help…

Q: How many different polypeptides would you expect to see synthesized by an in vitro translation…

A: The mRNA is a sequence of ribonucleotides that contains three possible reading frames. Only one…

Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…

A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from…

A: Codon is the triplet of either DNA or RNA nucleotides which codes for a specific amino acid during…

Q: Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids…

A: The process of synthesis of messenger RNA with the help of template DNA strand is called…

Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…

A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…

Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…

A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: Translate each changed sequence. Does the mutation result in a change in the amino acid sequence? If…

A: The genetic codon present in the mRNA will be translated into polypeptide chain by ribosome during…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction  The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…

A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…

Q: 1. Type uppercase letters for all the DNA bases and leave a blank space between them! DNA: 3'…

A: Transcription and translation are key forms in molecular science that convert the hereditary data in…

Q: 9) In another mutation from the original wild-type sequence, the bolded G in the middle of the…

A: The DNA is transformed into proteins through the process of transcription and translation.  The…

Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…

A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…

Q: Give the amino acid sequence with some little explanation please.   5′…

A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…

Q: Identify the type of mutation present in the CDS and discuss the implications on the protein.

A: Mutations are random alteration in the DNA structure which leads to mis-reading of Information on…

Q: How do you translate this into amino acid sequence

A: The process of synthesis of protein with the help of messenger RNA is called translation. In the…

Q: CGG CCA UGU AUA UAA Enter your answer as a string without dashes, using three-letter abbreviations…

A: DNA ( Deoxyribonucleic acid) is a ladder like helical structure which serves as genetic material in…

Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.