Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash.
Q: Suggest one possible way to effectively conserve declining diversity
A: Ecosystems provide foods, medicines, and energy, they regulate nutrient recycling and waste, they…
Q: 1) In the intracellular fluid, The TOTAL concentration of cations exceeds that of anions. True or…
A: Water makes up between 55 percent to 65 percent of body weight, depending on age, gender, and body…
Q: What are B and T cells and how do they relate to lymph nodes? 2. What are cell-surface antigens? How…
A: Introduction:- The remarkable specificity of adaptive immune responses is due to lymphocytes.…
Q: Insulin-like growth factor 2 (IGF2) is located on chromosome 11. My maternal copy of chromosome 11…
A: The IGF2 gene provides instructions for making a protein called insulin-like growth factor 2. It…
Q: Elucidate the fundamental challenges the aquatic vertebrates and terrestrial vertebrates face in…
A: Terrestrial vertebrae The human excretory system removes waste from the body through sweat, the…
Q: Biology ex. Locate any woodland or forest area close to your home. Create a 10 x 10 m quadrat once…
A: The goal of the research is to achieve the goal through the application of techniques. During the…
Q: 7. A 24-year-old schizophrenia patient with prominent cognitive symptoms and social impairment is…
A: Schizophrenia It is a condition when a person is unable to think, behave, speak, feel or respond…
Q: Where on your body đo microbes Iive? O A. On your skin O B. In your gut O C. In your mouth O D. All…
A: Microbes are small living beings present all over the place including soil, water and air. They are…
Q: In endochondral ossification, bone is formed from a template composed of: O epithelial membrane O…
A: Endochondral ossification is a embryonic process where bone starts formation by using hyaline…
Q: To predict: The reproductive success of captive-bred females released in the wild.
A: Our efforts to boost food production rely heavily on biological principles applied to animal…
Q: e. None of these 8. An earthquake hits the bay area, and you and your family have the choice of…
A: b. eat chicken then the beans beacause chiken can't be stored for longer days in earthquake…
Q: All of the fossil remains of the early hominins and australopithecines are found on the continent of…
A: Introduction Human evolution:- It is the process by which human beings developed on Earth from…
Q: A corpse was discovered in an apartment last November. It was that of a 50-year-old man who died of…
A: ANSWER;- post mortem interval is 7 hours
Q: Select the correct statement about cardiac output. A slow heart rate increases end diastolic…
A: Introduction Cardiac output is calculated by multiplying the stroke volume by the heart rate. The…
Q: 2. Does the FITT formula help you build physical fitness? Why or why not?
A: Introduction Any physiological action that improves or maintains physical fitness and general health…
Q: Write down the significance of Theoritical Plate .
A: A theoretical plate in many separation processes is a hypothetical zone or stage in which two…
Q: Remember for T/F questions, either answer TRUE or FALSE, but if the answer is FALSE make sure to…
A: Retention signal which are KDEL and KKXX sequences acts as a signal indicating the sorted out…
Q: Which of the following is true about Organogenesis? Choose all possible answers. anterior pituitary…
A: Organogenesis Organogenesis is defined as an important event of embryogenesis (embryo development)…
Q: In mitochondrial disorder, mutation in nuclear DNA may follow autosomal dominant, autosomal…
A: ANSWER) TRUE Mutation in unclear DNA can follow autosomal dominant, autosomal dominant, autosomal…
Q: rostaglandin-endoperoxide synthase 2, also known as cyclooxygenase- or COX-2, is an enzyme that in…
A: Prostaglandins directly act upon nerve endings to induce pain. They may also speed up the process of…
Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…
A: A calico cat is a homegrown cat of any variety with a tri-variety coat. The calico cat is generally…
Q: The G-proteins associated with GPCRS are made up of three subunits. In order to become active they…
A: G protein ha three subunit- Alpha Beta Gamma
Q: Q12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Flatworms, also known as flatworms, Platyhelminthes, or platyhelminths, are a phylum of bilaterian,…
Q: 4. Use the words presented in below to create a concept map illustrating the relationships among…
A: All these terms mentioned in the question, are related to the isolation, cultivation, and…
Q: There are many different sources of biomass and many ways of harnessing energy from biomass. Discuss…
A: Introduction The exponential rise in population and in increasing demand for food and fuel lead us…
Q: is/are performed by consumers, and equation(s) is/are performed by producers. a. I; II b. II; I c. I…
A: All organisms on earth require input of energy from its environment. we know that son is the source…
Q: The digestive tract and the gut microbiome have a mutualistic relationship. What does this mean? O…
A: Mutualism is a type of symbiotic relationship where all species involved benefit from their…
Q: Amount of ddt per organism
A: DDT, or dichlorodiphenyltrichloroethane, is a colourless, odourless, and tasteless crystalline…
Q: The diagram on the right has been drawn to scale. The width of the cell has been drawn at 5 cm. What…
A: Width = 5 cm Scale 1 cm = 10 um So 5 cm= 50 um So the magnification is size of image/ actual…
Q: How do humans contribute to ocean acidification/decreasing ocean pH and what is the backfire of this…
A: Introduction :- The capture of carbon dioxide from the atmosphere causes ocean acidification, which…
Q: Label the parts of the avian skeleton
A: Aves Aves are the vertebrates group that includes birds. They evolved from reptiles. Some examples…
Q: Most land animals with exoskeletons are smaller than the volume of a mouse, and most vertebrates are…
A: Insects belong to the phylum Arthropoda and it is the largest phylum in the animal kingdom…
Q: in your own words Sensory organs are essential anatomical features that helped lineages of…
A: Examples :- Birds are warm-blooded, and, although most are capable of flight, others are…
Q: The lumen of glomerular capillaries is lined by: Select one: juxtaglomerular cells. a. b.…
A: Glomerulus It is a tuft of blood capillaries nestled inside a cup like sac located at the end of…
Q: Describe or draw the process of creating a vesicle from an ER membrane OR fusing a vesicle with the…
A: A vesicle is a tiny cell structure made up of fluid and a lipid bilayer. Exocytosis, phagocytosis,…
Q: What made the pepper on water move upon the addition of the dishwashing liquid?
A: Water molecules are composed of two hydrogen molecules covalently bonded to one oxygen molecule.…
Q: Small molecules binding to histone proteins also control gene expression by chromatin remodelling…
A: Genes or DNA are generally coiled and held together by the help of structural proteins called…
Q: Q12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Flatworms Parenchyma is the tissue made up of cells and intercellular spaces that fills the interior…
Q: please help explain would SARS-CoV-2 N-nucleocasid protein be good target for neutralizing…
A: Severe acute respiratory syndrome (SARS)- coronavirus 2 (CoV-2) has caused the COVID-19 pandemic of…
Q: I need Plant Physiology Help Immediately Please If 2 molecules of phosphoglycolate are produced what…
A:
Q: QUESTION 1 You are studying a mutant strain of e.coli. When you add lactose to the media of this…
A: Lac operon is the segment of DNA which is involved in the breaking down of lactose into glucose in…
Q: Plants are highly dependent upon the resources of their enviroment. Explain how the lack of water…
A: In photosynthesis, two reaction has been shown light dependent reaction and light independent…
Q: ACTIVITY 27.1 Cells are divided to produce another cell. It is either mitosis or meiosis. Let's…
A: MITOSIS MEIOSIS Kind of cell Somatic cell Gametes / sex cells Number of cell division…
Q: Question 13 Staphylococcus aureus toxin responsible for symptoms associated with food poisoning is…
A: Staphylococcus aureus is a Gram-positive round-shaped bacterium.
Q: What happens to the size of cells as the cell number increases? Do they get bigger or smaller in…
A: Cell Growth: Cell growth is defined as an increase in a cell's total mass, which includes the volume…
Q: Describe the differences in the muscularis mucosa as you descend the esophagus and give the function…
A: The digestive system consist of alimentary canal and its glands in gastrointestinal tract.The…
Q: Which muscle cells would you use more of, if you train to run a marathon? O Slow twitch cells O Fast…
A: There are three types of muscle - A. Skeletal muscle - Voluntary and striated. B. Smooth muscle -…
Q: Which assumption below is not required for Hardy-Weinberg equilibrium? Random mating O Large…
A: The Hardy-Weinberg equilibrium is a principle stating that the genetic variation in a population…
Q: their 8-year old boy with progressive muscle weakness, and difficulty in motor skills resulting to…
A: DMD is an inherited disorder of progressive muscular weakness, typically in boys. It may follow a…
Q: Discuss completely the functions of the connective tissue of the dermis.
A: Introduction Dermis:- It is the inner layer of the two main layers of the skin, It is divided into…
Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this geneWhat is thee tRNA anticodon for the first 5’-ACGAUC-3’?
- Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?Telomerase supplies its own template RNA molecule as shown in Figure 3 below: B AAUCCCAAU TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the ends (5' and 3') on the DNA and RNA strand at position X, Y and Z, in the Figure 3. (ii) Draw and explain the two loop structures at the end of telomere.What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
- 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG(i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z are the ends of the DNA and RNA strands respectively. Identify ends of DNA’s X, Y, and Z shown in Figure 1(a) & (b). (ii) (a) Telomerase -AAUCCCAAU- TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W’ AАТСССААТСССААТСССАА-Х" (b) Telomeric DNA Figure 1EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .