Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example DNA TACAAAAACAAGGTAACGGTCATC mRNA AUGUUUUUGUUCCAUUGCCAGUAG AA Start-Phe-Leu- Phe-His-Cys-Gln-Stop DNA TAC-CTA-CTC-ATA-GAT-CTG-CTT-ATC mRNA AA :: GAU :: UAU :: UAG :: Methionine (Start) :: GAG :: Leucine :: Stop :: Tyrosine :: AUG :: GAA :: Glutamic Acid :: CUA :: GAC :: Serine :: Glycine :: Aspartic Acid

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Explain the term polycistronic mRNA.

A: An m RNA that can encode for many proteins is known as polycistronic m RNA.. This m RNA is present…

Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…

A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: Name and describe in DETAIL the three steps of translation.

A: Polymerization of amino acids to generate a chain of polypeptides is known as translation.…

Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…

A: Translation is a process in which protein is synthesized from the information contained in a…

Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…

A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…

Q: How would you choose where to begin your reading of a sequence in mRNA?  Which rule governing the…

A: The translation is the process by which polypeptide chain (protein) is produced from the mRNA…

Q: List the 4 types of RNA degradation and describe each in 1 sentence

A: RNA degradation is the process by which ribonucleic acid molecules are enzymatically degraded. It is…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: All of the following participate in the process of translation except:     ribosomes mRNA tRNA 35S…

A: Translation  It is defined as the process of production of proteins from the mRNA transcript. In…

Q: What is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUC

A: To determine the tRNA (transfer RNA) sequence corresponding to the given mRNA (messenger RNA)…

Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: Transcribe and translate the following DNA sequence (nontemplate strand);…

A: The gene is expressed into protein by the transcription and translation step.

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Give some points about the flow of information during translation?

A: Translation is the process of protein synthesis from mRNA (Messenger ribonucleic acid) with the help…

Q: The sequence: ATTGCCGACGACTTG is complementary to a sequence that is used as a template in…

A: (-) Sense

Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence

A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…

Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…

A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…

Q: Pick the most complete list of mRNA sequences that translate into Ser.   Question 3 options:…

A: According to the question, we have to find out the option which is the most complete list of mRNA…

Q: During initiation of translation, what protein is attached to the mRNA?     Initiation factors…

A: Translation is the process by which the genetic information encoded in messenger RNA (mRNA) is used…

Q: Describe a technique you would use to identify the location of mRNA in an organism.

A: ANS: Microarray analysis enables researchers to look at expression patterns across all of the genes…

Q: Describe protein biosynthesis. Define transcription and translation. What enzyme…

A: The cell biology is considered as the study of cells, their structure, and their functions. The…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription

A: Definition:  CRISPR:                  A segment of DNA compiled of short repetitions of base…