The following DNA fragment was isolated from the beginning of a gene. Determine which strand is transcribed, indicate the polarity of the two DNA strands, and then give the sequence of bases in the resulting mRNA and its polarity. CCCTACGCCTTTCAGGTT GGGATGCGGAAAGTCCAA

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…

A: Central dogma is the process where in the information stored in nucleic acids is transferred to…

Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…

Q: 1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids…

A: The genetic material DNA is converted into RNA and this mRNA codes for a specific protein which is…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: DNA TAC-TAA-AGG-GAA-GAC-GAG-ATC mRNA AA

A: DNA synthesis or DNA Replication-It is the process by which a cell duplicates its genome(DNA)…

Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…

A: DNA is double stranded & during replication both of its strands unwind to produce single…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: The knowledge included in the mRNA, which is created by replicating DNA, instructs the cell on the…

Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…

A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…

A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first…

A: DNA DNA is a genetic material from which amino acid sequence or polypeptide chain are made.

Q: 1. Type uppercase letters for all the DNA bases and leave a blank space between them! DNA: 3'…

A: Transcription and translation are key forms in molecular science that convert the hereditary data in…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…

Q: In the copies of each sequence below, divide the sequences into codons (triplets) by putting a slash…

A: DNA is a genetic material in most of the organism. It is two stranded ladder like structure which…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…

A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…

Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…

A: Let's rearrange the mRNA in the codes of three.  ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: Complete the box below:     Convert the following template strand of DNA bases into its…

A: The production of RNA from the DNA is known as transcription. This process is also known as gene…

Q: translation

A:

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.