DNA TAC-TAA-AGG-GAA-GAC-GAG-ATC mRNA AA

Q: Describe the process by which the information in eukaryotic gene is transcribed and translated into…

A: Eukaryotic gene expression is a complex process that involves transcription as well as translation.…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Draw a typical bacterial mRNA and the gene from which it was transcribed. Identify the 5′ and 3′…

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…

A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…

Q: Describe all the elements required to carry out the process of translation.

A: What is translation Translation refers  to the process of polymerization of amino acids to form a…

Q: In the process of translation, the input is and the output is O TRNA, MRNA O MRNA, protein O DNA,…

A: Translation is a process in which protein is synthesized from the information contained in a…

Q: TRANSCRIBE THE GENE INTO mRNA:   TACCAGTTAGTCGTAGA

A: Transcription is process of copying a DNA segment into RNA.

Q: Explain how precursor mRNA is modified to produce mRNA.

A: The central dogma of molecular biology briefs that DNA has instructions to synthesise proteins which…

Q: How would you choose where to begin your reading of a sequence in mRNA?  Which rule governing the…

A: The translation is the process by which polypeptide chain (protein) is produced from the mRNA…

Q: Interpret this mRNA strand and determine the proper sequence and shape of this protein:  AUG UCA CGC…

A: Introduction :- When transcription occurs, mRNA is produced. RNA polymerase decodes a single strand…

Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…

A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Give some points about the flow of information during translation?

A: Translation is the process of protein synthesis from mRNA (Messenger ribonucleic acid) with the help…

Q: Explain the elongation steps in bacterial translation

A: The translation is defined as the conversion of mRNA into proteins. The nucleotides in the group of…

Q: n the process of transcription, the input is and the output is O tRNA, DNA O MRNA, protein O DNA,…

A: the central dogma of molecular biology suggest that biological information flows from DNA to RNA to…

Q: Pick the most complete list of mRNA sequences that translate into Ser.   Question 3 options:…

A: According to the question, we have to find out the option which is the most complete list of mRNA…

Q: During initiation of translation, what protein is attached to the mRNA?     Initiation factors…

A: Translation is the process by which the genetic information encoded in messenger RNA (mRNA) is used…

Q: Describe a technique you would use to identify the location of mRNA in an organism.

A: ANS: Microarray analysis enables researchers to look at expression patterns across all of the genes…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Compare transcription to translation.  Which of the process is mostly related to errors?

A: Transcription vs Translation Initiation- The transcription process is the beginning of the gene…

Q: a) DNA fragment with instructions b) code c) is transcribed but not translated d) non-coding e)…

A: DNA, or deoxyribonucleic acid, is a molecule that contains the instructions an organism needs to…

Q: Define and identify the words listed below: CRISPR, codon, anti-codon, transcription

A: Definition:  CRISPR:                  A segment of DNA compiled of short repetitions of base…

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.