TRANSCRIBE THE GENE INTO mRNA:   TACCAGTTAGTCGTAGA

Q: What is the corresponding RNA sequence, if the DNA sequence reads TACACCTGG?

A: The RNA or ribonucleic acid is single stranded macromolecule that is composed of nucleotides. RNA is…

Q: DNAT  A  C       C  A  C        C  C  C       C  G  T         A  T  G        G  C  T      G  G  G…

A: DNA and RNA acts as a genetic matter that carry the genetic information from one generation to…

Q: Synthesize a Protein Below is a region of a gene. Transcribe the gene into a pre-mRNA strand.…

A: The DNA is the genetic material that is passed from one generation to the next generation. It is…

Q: TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype

A: Transcription is the process which produces mRNA from DNA by the action of RNA polymerase.…

Q: 9 Which of the following statements about transcription is not true? In both prokaryotes and…

A: Transcription is the process by which genetic information encoded in a gene's DNA sequence is copied…

Q: Define recognition sequence.

A: A restriction enzyme or restriction endonuclease is a protein, which can recognize a particular…

Q: Transcribe the DNA into mRNA.  Sequence A…

A: The process of synthesis of messenger RNA with the help of DNA template strand is called…

Q: Use the genetic code below to determine the third amino acid in the protein translated from the…

A: Introduction Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by the…

Q: type of mutation

A: If the sequence was mutated from CACGTAAAG to become CACCGTAAAG; single nucleotide insertion…

Q: What is the transcribed sequence

A: Sequence that is transcribed from the template DNA using complementary base pairing rules are known…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: plain the steps of translation. Include all molecules involved in the process and their role in the…

A: Every cell has a nucleus that houses genetic material, DNA.  Genes are the segments of…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: Below is the sequence of the yeast S cerevisiae GCN4 gene including 100 bp upstream and 100 bp…

A: Introduction to the topic of introns:Introns are non-coding regions of DNA that are transcribed into…

Q: Transcription and Translation Practice Directions: Read each sequence of DNA and transcribe it to…

A:

Q: The enzymatic activity necessary for proofreading is: O reverse transcription O ligase Oendonuclease…

A: DNA proofreading is the process through which the identification and the correction of errors in the…

Q: Please help transfer CAT AGG GAG to mRNA

A: Answer. DNA replication is a process that takes place inside the nucleus of the cell. During…

Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe…

A: Introduction: The process of polymerization of amino acid to form a polypeptide is called…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: 21. The processing events that must occur on the MRNA after it is transcribed, but before it is…

A: In eukaryotes, transcription and translation take place in different cellular compartments:…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Transcribe the gene to mRNA sequence and translate the mRNA gene to protein sequence.

A: Genes are sections of DNA which hold the information that are needed to make proteins. Transcription…

Q: If the promoter is here and transcription starts here…

A: Transcription is the process of formation of RNA using DNA as a template.

Q: ACCUAACGCGCCACACGUUCUCUAUUACCCCCC

A: In eukaryotic genes, the coding regions (exons) are interspersed with non-coding regions (introns).…

Q: Please draw the mature mRNA (before it is ready to be exported from nucleus):

A: In addition to their role in genetic information storage and transmission, nucleic acids are also…

Q: Transcribe the following DNA sequence from HbS. Record your answer to submit for grading. DNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Based on sequences A,B,C. Provide an anticodon sequence that would build this protein.

A: Codons are the sequences of nucleotides present on the mRNA strand, the tRNA (transfer RNA) brings…

Q: What would be the tRNA anticodons for the mRNA in question 3

A: Answer- ATGGATCT CGA- UACCUAGA GCT will be the following anti-codons .

Q: Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very…

A: Introduction Transcription : It Is The Initial Stage In Gene Expression, Which Involves "The…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.