Proteins
We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.
Protein Expression
The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.
Based on sequences A,B,C. Provide an anticodon sequence that would build this protein.
Sequence A
TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGT
Sequence B
TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACT
Sequence C
TACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG

Codons are the sequences of nucleotides present on the mRNA strand, the tRNA (transfer RNA) brings amino acids corresponding to these codons. One end of tRNA consists of anticodons that help in their complementary binding with mRNA strand and another end of tRNA has the amino acids that belong to the specific codon of mRNA.
Step by step
Solved in 3 steps









