a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of impact will this mutation have on the functionality of the protein? Second Letter UAU Tyr UAC UUU UCU UGU UGC Phe Cys C UUC UUA UUG UCC UCA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G Leu UCG CGU CAU His CCU C CCA G CUU CUC CAC CGC Leu CUA Arg Pro CGA CGG CAA Gin CUG CAG AUU AUC lle AUA AUG Met ACG ACU ACC ACA AAU Asn AAC The AAA AGU AGC Ser AGA AAG Lya AGG Arg GCU GCC GUU GAU GAC GAA GAG GGU GGC Gly Asp GUC Val GUA Ala GCA GCG GGA Glu GGG GUG ACC T C A G. G. 6. G G A C T. T. G. Original DNA strand G T A G. G. T. G. G. GA CT T. G. Mutated DNA strand First letter Third letter

Q: Explain why a point mutation does not necessarily change the oriignal amino acid sequence.  Explain…

A: A mutation refers to the alteration in the sequence of nucleotides in an organism’s DNA…

Q: 63. Given the single stranded DNA shown below (written 5' to 3') and the genetic code, which…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: Glycosylation is a major type of protein post-translational modification. Identify the amino acid…

A: Cavalent or generally enzymatic reactions takr place after or during translation are termed as post…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…

Q: A solution of peptide of unknown sequence was divided into 2 samples. One sample was tre with…

A: Site specific proteases are enzymes that cleaves polypeptide chains only at specific sites i.e. at…

Q: Define mutation. Then describe the three basic types of mutation (substitutions, insertions, and…

A: A mutation is an alteration in the DNA sequence that mainly arises during the replication of DNA or…

Q: Translate the given amino acid sequence into one-letter code.…

A: Genetic codons are long enough to be taken in account in research purposes. So as for such, some…

Q: If a gene for a polypeptide has a mutation that causes an amino acid change but the new amino acid…

A: Mutation is molecular change in the DNA sequence of a gene. Mutations in the coding sequence of a…

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: What amino acid sequence is coded by the following mRNA base sequence?

A: Genetic code is the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid…

Q: A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the…

A: To explain--M1: Met-Ser-Ser-Arg-Leu-Glu-GlyThis mutation involves the substitution of Pro with Ser.…

Q: Figure out the mutation. You will need the codon table to answer this question. Wild type DNA…

A: DNA is two strand ladder like structure which consists of :-  A ) Coding strand  B ) Template strand…

Q: List the 4 types of protein modification and describe each in 1 sentence

A: Protein modification refer to any change in the chemical composition of proteins following…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: Ans a. The type of mutation shown below is point mutaion. A point mutation or replacement is a…

Q: The normal sequence of a protein is: Met – Thr – Lys – His – Ser – Ser ... Mutations of the DNA…

A: In this problem, the normal sequence of a protein is given, and three different protein sequences…

Q: Which of the following could be the DNA template for the following protein primary structum…

A: The DNA is transcribed to produce the mRNA which gets translated into protein. Proteins are polymers…

Q: kle cell hemoglobin DNA ÇACGTAGA CTGAGG ACA ckle cell hemoglobin MRNA ckle cell hemoglobin AA…

A: Sickle cell anaemia is a inherent condition in which red blood cells are abnormally fickle shaped…

Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: Complete the labels for the following diagram of translation. NOTE: A is the product of this…

A: Translation is the second step of gene expression in which information from mRNA is encoded into the…

Q: What is the sequence of the peptide that would result following translation with a ribosome?…

A: Translation is the process in which the mRNA is converted into a long chain of polypeptide called…

Q: Describe the effect on the protein if the base pair #6 in the parent DNA chain is misted from G/C to…

A: Deoxyribonucleic acid (DNA) is the foremost key genetic constituent of all life forms. It is further…

Q: 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that…

A: The amino acids in the given sequence are leucine, tyrosine, glycine, glycine, and valine.

Q: describe a mutation that does not alter the amino acid sequence of a protein

A: introduction A mutation is a change in a DNA sequence. Mutations can result from DNA copying…

Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: When there is an error in the DNA sequence during replication it causes a change in the DNA…

Q: . A geneticist examined the amino acid sequence of aparticular protein in a variety of E. coli…

A: Base substitution is a type of mutation in which a single nucleotide is affected. It is caused by…

Q: Identify a disease or condition related to protein mis-folding.  Which protein is misfolded?  Is…

A: Accumulation of misfolded proteins cause disease various neurodegenerative diseases, such as amyloid…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.