B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a transition leading to a silent mutation in the second amino acid. Bold or underline the nucleotide that has been changed

Q: Explain how in some cases a single nucleotide change in a DNA sequence can have very detrimental…

A: Mutations is the sudden heritable change in the make up of gene. Mutation basically occur by…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got…

A: The hypothetical protein considered here consists of the amino acid sequence arginine,…

Q: E. How many nucleotides would be required to generate a polypeptide that is 15 amino acids long?…

A: The genetic code is a sequence of three-letter combinations of nucleotides called codons, each…

Q: Complete the table. For the polypeptide, use the three-letter code. Note: Reference the Genetic code…

A: Genetic code table basis:Reference:…

Q: Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A missense mutation is a type of point mutation where a single nucleotide change in the DNA sequence…

Q: . What are three differences between RNA and DNA?

A: As per our honor code, We are authorized to answer one question at a time, since you have not…

Q: b) Draw a diagram to show how nucleotides are organised in the structure of DNA. Note: You need only…

A: The four most important biomolecules in living things are carbohydrates, amino acids, lipids, and…

Q: 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You…

A: A transfer RNA (tRNA) is a unique type of RNA molecule with the essential function of facilitating…

Q: Optional) Describe the structure of DNA, discussing the DNA helix and the base pairs of ONA, the…

A: Introducion There are two types of  nucleic acid present in our body. DNA and RNA. DNA acts as a…

Q: at is the difference between sickle-cell A sequence and normal DNA sequence? . Normal DNA sequence:…

A: Any abrupt changes in the DNA sequence results in a mutation. This may or may not change the…

Q: Describe three outcomes of base substitutions.

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: B. A polypeptide has 51 amino acids in its primary structure. (i) What is the minimum number of DNA…

A: Introduction DNA resides in the sequence of four nucleotides. The genetic code is a triplet code…

Q: C. Two mutations are known in the population, one shaded in yellow and one in blue, in the TEMPLATE…

A:

Q: DIRECTION: Express the following DNA nucleotide bases into amino acids. A. 1. 3' ATA TTT CCG TAC CGC…

A: Answer: Introduction: Amino acid required for energetic procedures like the building of proteins and…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ -Write the sequence of the RNA molecule that will be…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Identify the base labeled B. cytosine thymine O adenine O guanine A C B D

A: Nucleotides are the building blocks of DNA and RNA. Nucleotide is composed of a sugar, phosphate and…

Q: Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is…

A: Proteins are important for the normal functioning of the human body. Proteins are made of amino…

Q: 1. Explain why DNA fragments can be separated using an electric current. How does the size of the…

A: 1.DNA fragments can be separated by the application of current this process of separating DNA occurs…

Q: Draw a generalized nucleotide. Just put “base” instead of drawing the actual base. Label the carbons…

A: Nucleotides are the monomer units of biological polymers nucleic acids (DNA and RNA). They composed…

Q: Provide a brief definition for a polymorphic protein

A: Polymorphism means have many types of morphology and structure. It is a condition when more than one…

Q: Draw and label a diagram showing four DNA nucleotides, linked together in two strands. PLEASE DRAW…

A: Nucleic acids are biomolecules responsible for the storage and transmission of genetic information…

Tissue regeneration & repair

Tissue regeneration involves the restoration of tissue components by regrowth of damaged tissues. In contrast, tissue repair involves patching of injured tissue rather than restoring it. It is the proliferative capacity of the cells that decides the amount of regeneration against the repair that would occur in the tissue. Both regeneration and repair depending on the duration of the injury and response to the inflammation.