(a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg). As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts a-d
(a.) When a mutation occurs to the given sequence of DNA, it will be;
5' CTATAAGGCGCAAATTCCTGCCAT 3'
Then the mRNA sequence will be,
5' GAUAUUCCGCGUUUAAGGACGGUA 3'
Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val)
(b.) When a mutation occurs to the given sequence of DNA, it will be;
5' CTATAAGGCGGAAATCCCTGCCAT 3'
Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3'
Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val)
(c.) When a mutation occurs to the given sequence of DNA, it will be;
5' CTATAAGGCTCAAATCCCTGCCAT 3'
Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3'
Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val)
(d.) When a mutation occurs to the given sequence of DNA, it will be;
5' CTATAAGGCGCAAATCCCTCCAT 3¹
Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3'
Amino acids - (Asp Leu Pro Arg Leu Gly Arg).
As the last sequence contains only 2 bases it will not represent any amino acid.
question: Choose the types of mutations caused by the changes in parts a-d

Trending now
This is a popular solution!
Step by step
Solved in 3 steps









