A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein sequences (N-C terminus) using the single letter abbreviations for each 5' GCA UAU CCU UGU GAU 3' B) Identify the two unique amino acids in the protein sequence above, provide their full names and brief explanation why you chose them C) Draw the two amino acids from 3. connected with a peptide bond to each other (with free amino and carboxy termini) at physiological pH

Q: C4GUCAGUCAGUCO/ Use the codon chart to determine the following RNA strand in amino acids (Remember…

A: Genetic code The relationship between the sequence of amino acids in a polypeptide chain and…

Q: (b) r , The following polypeptide sequence has three alpha helices and two B turns. Based on what we…

A: An amino group and an acid group-containing organic molecules are called Amino acids.…

Q: Which amino acid residue is preferred at which position in the following peptide for cleavage by…

A: While writing a polypeptide, the left side is the N terminus and the right side is the C terminus.

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Consider the following in light of the concept of levels of structure (primary, secondary, tertiary,…

A: In double stranded DNA structure two strands run in anti-parallel directions through base pairing…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Wild type sequence : Met Ser Pro Arg Leu Glu Gly    Mutant 1: Met Ser Pro   After pro, the peptide…

Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…

A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: The following are sequences from three different alpha helices found in human proteins:…

A: The proteins are constituted of twenty naturally occurring amino acids connected via peptide…

Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:…

A: Introduction: A number of enzymes catalyze the breakdown of peptide bonds at a specific site in an…

Q: If one DNA strand has the nucleotide sequence below, what is the nucleotide sequence on its…

A: DNA and RNA are the two types of nucleic acids. Deoxyribose nucleic acid (DNA) is present in all…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: Given the structures of the ribonucleotides as (shown in Image A) and deoxyribonucleotides (as shown…

A: Explain;- The polyribonucleotide UAGCCUG consists of six nucleotides, each of which contains a…

Q: You could use absorbance at 280nm or colorimetric assays like the Bradford assay or bicinchoninic…

A: There are different methods present to measure the concentration of a given protein.

Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…

A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…

Q: Assume that the 3 polypeptide strands shown below form a parallel B-sheet. Select amino acids AA1,…

A: Beta sheet is one of type of secondary structure in which inter strand hydrogen bonds is formed…

Q: ive the sequence of every codon this tRNA, with the anticodon 5'AGG3

A: Genetic code is very important to understand the codon –anticodon phenomena. As known that the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.