Match the THE BEST DESCRIPTION with the proper enzyme.RNA Polymerase IRNA Polymerase IIRNA Polymerase IIIDNA Polymerase Iaminoacyl-tRNA synthetasesDNA Polymerase IIIRF1[Choose ]✓ MAINLY synthesizes ribosomal RNARecognizes stop codons and halts the process of protein translationThe most important enzymes involved in interpreting the genetic code.Part of a processive complex that does most of the work placing nucleotides in DNA replication.Synthesizes messenger RNA precursorsMAINLY synthesizes transfer RNAHas 5' to 3' exocnuclease activity and participates in primer removalMAINLY synthesizes transferHas 5' to 3' exocnuclease actThe most important enzymePart of a processive complexRecognizes stop codons and

The central dogma of molecular biology is a theory that describes the flow of genetic information in…

Answered: Match the THE BEST DESCRIPTION with the…

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Transcribe the given DNA sequences to mRNA. DNA: 5'-GATCCGC-3' DNA: 5'-TTACGCTAA-3' DNA: 5'-ACGTCAATGGA-3' DNA: 5'-GCGCGGATTAGCGAT-3' mRNA: 3'- mRNA: 3'- mRNA: 3'- mRNA: 3'- -5' -5' -5' -5'
Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…
A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter U A G Letter phenylalanine serine tyrosine cysteine U phenylalanine serine tyrosine cysteine U leucine serine stop stop A tryptophan arginine arginine leucine serine stop leucine proline histidine U leucine proline histidine leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine A isoleucine threonine lysine arginine A methionine threonine lysine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine G valine alanine glutamate glycine A valine alanine glutamate glycine G O Met-lle-Thr-Ala-STOP O Met-Ser-Thr-Ala-STOP Met-Ser-Trp-Arg-STOP Met-Tyr-Thr-Arg-STOP
Name of the enzyme that adds RNA Nucleotides during Transcription? O Helicase O Primase DNA Polymerase O RNA Polymerase 9MD
Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then translated into amino acids. Complete the DNA-to-amino acid table for three consecutive codons with the appropriate nucleotides and amino acids using a codon table. Nucleotide and amino acid options can be used multiple times or not at all. 5' to 3' DNA strand 3' to 5' DNA strand transcribed mRNA tRNA anticodon amino acid arginine cysteine leucine T A U A T G A U arginine leucine A proline T A U Answer Bank A G G с с T T A A U glutamic acid U G C G с с glutamic acid G G G с с G C arginine C G с G
A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter Letter phenylalanine phenylalanine serine tyrosine tyrosine cysteine cysteine U serine leucine serine stop stop A leucine serine stop tryptophan arginine G leucine proline histidine leucine proline histidine arginine leucine proline glutamine arginine arginine A leucine proline glutamine isoleucine threonine asparagine asparagine lysine serine isoleucine threonine serine A isoleucine threonine arginine methionine threonine lysine aspartate arginine valine alanine glycine glycine valine alanine aspartate C G valine alanine glutamate glycine glycine A valine alanine glutamate O Met-lle-Thr-Ala-STOP O Met-Ser-Trp-Arg-STOP O Met-Tyr-Thr-Arg-STOP O Met-Ser-Thr-Ala-STOP
For each mutant, state what change has occurred in the DNA, whether it was a substitution by transition or transversion, sense mutation, nonsense or reading frame change. It must present the codon sequence. Normal nucleotide sequence starting from the third codon: CCC-ACG-GUG-ACG-ACA-CGG-UGG Please show the codon and nucleotide sequence of the mutation.
40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letter
Write if TRUE/FALSE. mRNA splicing takes place in bacteria. In eukaryotes, replication and transcription takes place in the nucleus. Sigma subunit guides the RNA polymerase to locate the promoter region in RNA. The direction of synthesis of DNA and RNA is the same, from 5’→3’ direction. The Okazaki fragment forms when the synthesis of the DNA strand runs toward the replication fork.
RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||
Please answer both question.its all a one question.otherwise I will give downvote. Below is a double strand DNA sequence contain a gene and it will go under transcription, suppose that the 3/ → 5/ is the template strand: 3/-TAC-GAC-CGT-TGG-CTT-CTG-TGT-AGG-TAT-ACC-GAT-ACT-5/ 5-/ATG-CTG- GCA-ACC-GAA-GAC-ACA-TCC-ATA-TGG-CTA-TGA-3/ 1- Write down the mRNA transcript with direction of ends of the strand? 2- Construct the resulted polypeptide chain from translation of the mRNA above based on the following codons translation below AUG: Methionine GCA: Alanine ACC: Threonine UGA: write its name GAA: Glutamic acid GAC: Aspartic acid CUG: Leucine ACA: Threonine UCC: Serine AUA: Isoleucine UGG: Tryptophan CUA: Leucine
Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A missense mutation that is also a transversion

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning