4. A peptide was cleaved into smaller fragments using chymotrypsin and CnBr. The fragments were separated by HPLC and then sequenced by Edman degradation. Determine the sequence of the original peptide from the following fragment sequences. Cleavage with chymotrypsin Cleavage with CnBr EAGPDGMECAF ЕCАFHR GPF CKWEAGPDGM EAAMCKW IAHTYGPFEAAM HR ТАНТY -align the peptides Reagent (source) Trypsin (bovine pancrease) Chymotrypsin (bovine pancrease) Staphylococcus V8 protease Pepsin (porcine pancrease) Cyanogen bromide (chemical)(CnBr) Specificity Lys, Arg (C) Phe, Trp, Tyr (C) Glu, Asp (C) Phe, Trp, Tyr (N) Met (C)

Q: What would be the 5 first nucleotides that form the mRNA?

A: Transcription is an important step in the gene expression in eukaryotes and Prokaryotes. It involves…

Q: If a protein with the sequence AGFEWPRQVDMARINE is treated with chymotrypsin, what will the products…

A: Proteins are made up of amino acids. Two amino acids are joined by a peptide bond in a protein.…

Q: Product(wrong) Substrate(wrong) Ku+ nil Ꮩw . IVW Pre-translocation ky+ ky+ KIV+ / niv Err* k₁. ky-nG…

A: High fidelity gene transcription and replication require kinetic discrimination of nucleotide…

Q: Please ASAP. Thank you OPTIONS a. Arg-Val-His b. Lys-Val-His c. Pro-Gly-Trp d. Met-Leu-Ser…

A: A codon is a trinucleotide arrangement of DNA/RNA that compares to a particular amino acid The…

Q: Apeptide was sequenced and the sequence of fragment sets generated by different cleavage methods is…

A: Amino acids are the molecules that join to form a protein structure. The bond formed between two…

Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…

A: We are given a sequence of DNA in 5'-3' direction.  We have to generate the mRNA sequence and then a…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: Mutation -  Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…

Q: ABOUT Phenylketonuria Explain Potential technical issues and limitations of PCR technology are…

A: Phenylketonuria (PKU) is a metabolic disorder in which the amino acid phenylalanine is not properly…

Q: What is the codon for the MRNA? DNA coding strand bases messenger RNA non-coding strand

A: There are four bases Adenine(A), Guanine(G), Cytosine(C), Uracil(C).

Q: A C mRNA (Met Gly F GGG AUGCCCACG UAG Which letter indicates the amino end of the growing…

A: A covalent link known as a peptide bond connects the carboxyl group (-COOH) of one amino acid to the…

Q: 24

A: GWAS is genome wide association study. The GWAS studies helps to identify genes association with a…

Q: Describing Functions: Building Vocabulary Skills In your own words, define each of the following in…

A: Translation process takes place in the cytoplasm of the cell. It involves tRNA, mRNA, large and…

Q: THCA 100 This reaction is Entropy is THC ( Leafly Mur AD RNA polymerase ATGACGOATCAGCCOCAAG…

A: Tetrahydrocannabinol Acid when heated converts into delta-9-tetrahydrocannabinol. the reaction is…

Q: You have identified a mutation. In the normal organism the DNA TEMPLATE strand is 5'AGT3' in the…

A: Mutations are changes in the sequence of DNA which may or may not affect the phenotype of the…

Q: kle cell hemoglobin DNA ÇACGTAGA CTGAGG ACA ckle cell hemoglobin MRNA ckle cell hemoglobin AA…

A: Sickle cell anaemia is a inherent condition in which red blood cells are abnormally fickle shaped…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: codon table st ition A U Phe Ser Tyr Phe Ser Tyr Leu Ser stop Leu Ser stop Leu C Leu Leu Leu Pro His…

A: In the sequence fill ups we can see that few sequences are given in DNA, mRNA,  tRNA and  amino…

Q: ✓ Part B What further experiment should be carried out in order to determine the primary structure…

A: Introduction Protein is the most abundant macromolecule in our body.  Amino acids are the building…

Q: Two complete sets of overlapping peptides, created with two different cleavage methods, are used in…

A: The technique used to determine the amino acid sequence of a protein is known as protein sequencing.…

Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: The anticodon sequence created from the following DNA: TACGGGGCTGAGATT Select one: O a.…

A: The sequence of nucleotides that complement codons is known as an anticodon. They are found in tRNAs…

Q: 2ith the diagram provided please write the polypeptide. sequence obtained from the translation of…

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Gene is a part of the DNA, located on a specific site on the chromosome and has a specific sequence…

Q: me e File Content Edit X view Tator Biol 140 X BOBILI Content X Begin:…

A: This worksheet is related to  transcription and translation which are related to the synthesis of…

Q: G. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…

A: Introduction :- A mutation is a change in our DNA sequence that happens as a result of errors in DNA…

Q: 10 SCNSA-SCN10A CDKN1A HAND1 VTI1A SYT1 MYOCD :

A: Answer :- In the 2019 GWAS study focused on identifying loci impacting the risk of prolonged QRS…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: A mutation is a change in a DNA sequence. It can result from DNA copying mistakes made during cell…

Q: Which of the following sequences would pair best with this sequence: 5'-CGATTCGA-3' O 5'-UCGAAUCG-3'…

A: In DNA, the nitrogenous bases adenine (A) pairs with thymine (T), and cytosine (C) pairs with…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.