Homework Help is Here – Start Your Trial Now!
Science
Biochemistry
The template strand of a segment of double-helical DNA contains the sequence (5') CTTAACACCCCTGACTTCGCGCCGTCG (3') What is the base sequence of the mRNA that can be transcribed from this strand? (5') GCUACGCGCCGAAGUCAGGGGUGUUAA Incorrect Answer What amino acid sequence could be coded by this mRNA, starting from the 5' end? Enter the sequence using the one-letter amino acid codes. amino acid sequence: ATRVRGRVKL Incorrect Answer If the complementary (nontemplate) strand of this DNA sequence were transcribed and translated, would the resulting amino acid sequence be the same? Why or why not? Yes, both an amino acid codon and its complement code for the same amino acid. Yes, the complementary antiparallel strands in double-helical DNA have the same base sequence in the 5'-3' direction. No, the complementary antiparallel strands in double-helical DNA do not have the same base sequence in the 5'-3' direction. No, the nontemplate strand contains a stop codon, resulting in the production of a truncated peptide. Correct Answer (3') Feedback Sorry, that's incorrect. You have not correctly entered the base sequence of the mRNA transcript. The template strand serves as the template for mRNA synthesis, whereas the nontemplate strand is identical in sequence to the mRNA transcribed from the gene, with U in place of T. The template strand undergoes transcription in the 3'-5' direction. Thus, the 5' end of the mRNA sequence aligns with the 3' end of the template strand.

The template strand of a segment of double-helical DNA contains the sequence (5') CTTAACACCCCTGACTTCGCGCCGTCG (3') What is the base sequence of the mRNA that can be transcribed from this strand? (5') GCUACGCGCCGAAGUCAGGGGUGUUAA Incorrect Answer What amino acid sequence could be coded by this mRNA, starting from the 5' end? Enter the sequence using the one-letter amino acid codes. amino acid sequence: ATRVRGRVKL Incorrect Answer If the complementary (nontemplate) strand of this DNA sequence were transcribed and translated, would the resulting amino acid sequence be the same? Why or why not? Yes, both an amino acid codon and its complement code for the same amino acid. Yes, the complementary antiparallel strands in double-helical DNA have the same base sequence in the 5'-3' direction. No, the complementary antiparallel strands in double-helical DNA do not have the same base sequence in the 5'-3' direction. No, the nontemplate strand contains a stop codon, resulting in the production of a truncated peptide. Correct Answer (3') Feedback Sorry, that's incorrect. You have not correctly entered the base sequence of the mRNA transcript. The template strand serves as the template for mRNA synthesis, whereas the nontemplate strand is identical in sequence to the mRNA transcribed from the gene, with U in place of T. The template strand undergoes transcription in the 3'-5' direction. Thus, the 5' end of the mRNA sequence aligns with the 3' end of the template strand.

Biochemistry
Biochemistry
9th Edition
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Chapter1: Biochemistry: An Evolving Science
Section: Chapter Questions
Problem 1P
See similar textbooks
icon
Related questions
Question

please help with this

The template strand of a segment of double-helical DNA contains the sequence (5') CTTAACACCCCTGACTTCGCGCCGTCG (3') What is the base sequence of the mRNA that can be transcribed from this strand? (5') GCUACGCGCCGAAGUCAGGGGUGUUAA Incorrect Answer What amino acid sequence could be coded by this mRNA, starting from the 5' end? Enter the sequence using the one-letter amino acid codes. amino acid sequence: ATRVRGRVKL Incorrect Answer If the complementary (nontemplate) strand of this DNA sequence were transcribed and translated, would the resulting amino acid sequence be the same? Why or why not? Yes, both an amino acid codon and its complement code for the same amino acid. Yes, the complementary antiparallel strands in double-helical DNA have the same base sequence in the 5'-3' direction. No, the complementary antiparallel strands in double-helical DNA do not have the same base sequence in the 5'-3' direction. No, the nontemplate strand contains a stop codon, resulting in the production of a truncated peptide. Correct Answer (3') Feedback Sorry, that's incorrect. You have not correctly entered the base sequence of the mRNA transcript. The template strand serves as the template for mRNA synthesis, whereas the nontemplate strand is identical in sequence to the mRNA transcribed from the gene, with U in place of T. The template strand undergoes transcription in the 3'-5' direction. Thus, the 5' end of the mRNA sequence aligns with the 3' end of the template strand.
Transcribed Image Text:The template strand of a segment of double-helical DNA contains the sequence (5') CTTAACACCCCTGACTTCGCGCCGTCG (3') What is the base sequence of the mRNA that can be transcribed from this strand? (5') GCUACGCGCCGAAGUCAGGGGUGUUAA Incorrect Answer What amino acid sequence could be coded by this mRNA, starting from the 5' end? Enter the sequence using the one-letter amino acid codes. amino acid sequence: ATRVRGRVKL Incorrect Answer If the complementary (nontemplate) strand of this DNA sequence were transcribed and translated, would the resulting amino acid sequence be the same? Why or why not? Yes, both an amino acid codon and its complement code for the same amino acid. Yes, the complementary antiparallel strands in double-helical DNA have the same base sequence in the 5'-3' direction. No, the complementary antiparallel strands in double-helical DNA do not have the same base sequence in the 5'-3' direction. No, the nontemplate strand contains a stop codon, resulting in the production of a truncated peptide. Correct Answer (3') Feedback Sorry, that's incorrect. You have not correctly entered the base sequence of the mRNA transcript. The template strand serves as the template for mRNA synthesis, whereas the nontemplate strand is identical in sequence to the mRNA transcribed from the gene, with U in place of T. The template strand undergoes transcription in the 3'-5' direction. Thus, the 5' end of the mRNA sequence aligns with the 3' end of the template strand.
Expert Solution
steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Recommended textbooks for you
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781319114671
Author:
Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:
W. H. Freeman
Lehninger Principles of Biochemistry
Lehninger Principles of Biochemistry
Biochemistry
ISBN:
9781464126116
Author:
David L. Nelson, Michael M. Cox
Publisher:
W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul…
Fundamentals of Biochemistry: Life at the Molecul…
Biochemistry
ISBN:
9781118918401
Author:
Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:
WILEY
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781305961135
Author:
Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:
Cengage Learning
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781305577206
Author:
Reginald H. Garrett, Charles M. Grisham
Publisher:
Cengage Learning
Fundamentals of General, Organic, and Biological …
Fundamentals of General, Organic, and Biological …
Biochemistry
ISBN:
9780134015187
Author:
John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:
PEARSON
SEE MORE TEXTBOOKS