The template strand of a segment of double-helical DNA contains the sequence (5') CTTAACACCCCTGACTTCGCGCCGTCG (3') What is the base sequence of the mRNA that can be transcribed from this strand? (5') GCUACGCGCCGAAGUCAGGGGUGUUAA Incorrect Answer What amino acid sequence could be coded by this mRNA, starting from the 5' end? Enter the sequence using the one-letter amino acid codes. amino acid sequence: ATRVRGRVKL Incorrect Answer If the complementary (nontemplate) strand of this DNA sequence were transcribed and translated, would the resulting amino acid sequence be the same? Why or why not? Yes, both an amino acid codon and its complement code for the same amino acid. Yes, the complementary antiparallel strands in double-helical DNA have the same base sequence in the 5'-3' direction. No, the complementary antiparallel strands in double-helical DNA do not have the same base sequence in the 5'-3' direction. No, the nontemplate strand contains a stop codon, resulting in the production of a truncated peptide. Correct Answer (3') Feedback Sorry, that's incorrect. You have not correctly entered the base sequence of the mRNA transcript. The template strand serves as the template for mRNA synthesis, whereas the nontemplate strand is identical in sequence to the mRNA transcribed from the gene, with U in place of T. The template strand undergoes transcription in the 3'-5' direction. Thus, the 5' end of the mRNA sequence aligns with the 3' end of the template strand.
The template strand of a segment of double-helical DNA contains the sequence (5') CTTAACACCCCTGACTTCGCGCCGTCG (3') What is the base sequence of the mRNA that can be transcribed from this strand? (5') GCUACGCGCCGAAGUCAGGGGUGUUAA Incorrect Answer What amino acid sequence could be coded by this mRNA, starting from the 5' end? Enter the sequence using the one-letter amino acid codes. amino acid sequence: ATRVRGRVKL Incorrect Answer If the complementary (nontemplate) strand of this DNA sequence were transcribed and translated, would the resulting amino acid sequence be the same? Why or why not? Yes, both an amino acid codon and its complement code for the same amino acid. Yes, the complementary antiparallel strands in double-helical DNA have the same base sequence in the 5'-3' direction. No, the complementary antiparallel strands in double-helical DNA do not have the same base sequence in the 5'-3' direction. No, the nontemplate strand contains a stop codon, resulting in the production of a truncated peptide. Correct Answer (3') Feedback Sorry, that's incorrect. You have not correctly entered the base sequence of the mRNA transcript. The template strand serves as the template for mRNA synthesis, whereas the nontemplate strand is identical in sequence to the mRNA transcribed from the gene, with U in place of T. The template strand undergoes transcription in the 3'-5' direction. Thus, the 5' end of the mRNA sequence aligns with the 3' end of the template strand.
Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN:9781305251052
Author:Michael Cummings
Publisher:Michael Cummings
Chapter9: Gene Expression And Gene Regulation
Section: Chapter Questions
Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...
Related questions
Question
please help with this
Transcribed Image Text:The template strand of a segment of double-helical DNA contains the sequence
(5') CTTAACACCCCTGACTTCGCGCCGTCG (3')
What is the base sequence of the mRNA that can be transcribed from this strand?
(5')
GCUACGCGCCGAAGUCAGGGGUGUUAA
Incorrect Answer
What amino acid sequence could be coded by this mRNA, starting from the 5' end? Enter the sequence using the one-letter
amino acid codes.
amino acid sequence:
ATRVRGRVKL
Incorrect Answer
If the complementary (nontemplate) strand of this DNA sequence were transcribed and translated, would the resulting
amino acid sequence be the same? Why or why not?
Yes, both an amino acid codon and its complement code for the same amino acid.
Yes, the complementary antiparallel strands in double-helical DNA have the same base sequence in the
5'-3' direction.
No, the complementary antiparallel strands in double-helical DNA do not have the same base sequence in the
5'-3' direction.
No, the nontemplate strand contains a stop codon, resulting in the production of a truncated peptide.
Correct Answer
(3')
Feedback
Sorry, that's incorrect.
You have not correctly entered the base
sequence of the mRNA transcript.
The template strand serves as the
template for mRNA synthesis, whereas
the nontemplate strand is identical in
sequence to the mRNA transcribed
from the gene, with U in place of T.
The template strand undergoes
transcription in the 3'-5' direction.
Thus, the 5' end of the mRNA
sequence aligns with the 3' end of the
template strand.
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by step
Solved in 2 steps
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning
Biology Today and Tomorrow without Physiology (Mi…
Biology
ISBN:
9781305117396
Author:
Cecie Starr, Christine Evers, Lisa Starr
Publisher:
Cengage Learning
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning
Biology Today and Tomorrow without Physiology (Mi…
Biology
ISBN:
9781305117396
Author:
Cecie Starr, Christine Evers, Lisa Starr
Publisher:
Cengage Learning