pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' s eldmease of bea pried 2 bnisua Aim piwollot erdT .E | transcription RNA strandUU uO UU A-emozodin 5'-CGUAUUGUCUCCUUA-3' J J JL s yd bnsita ebilgeqylog s neb1o toso ien erit o efiW (s) bluow terdt aspnso e oot isone polypeptide translation vimetis ne ebivo19 (d) ent ot etslens Key:

Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…

A: 5' cap  help in translation and prevent degradation of m- RNA  and poly A tail help on initiation of…

Q: Obj 29. Identify the specific terms applied to the process of protein synthesis described by each…

A: Epinephrine, also known as adrenaline, is a hormone and neurotransmitter that plays a critical role…

Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…

A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: Question 41 What is specifically illustrated in the figure below? Self- complementary sequence RNA…

A: In the image shown, we can see two strands of DNA, unwinded, RNA polymerase, RNA being transcribed…

Q: Complete the table. For the polypeptide, use the three-letter code. Note: Reference the Genetic code…

A: The collection of instructions that allow living cells to convert information contained in genetic…

Q: Molecule Sequence Hb A DNA 5’ GGC AGA CTT CTC CTC AGG AGT CAG GTG CAC 3’ Hb A mRNA   Hb A…

A: Specific DNA sequences encode hemoglobin, a critical molecule for oxygen delivery in red blood…

Q: 6. Refer to the figure answer the following questions. CLUSTAL W (1.83) multiple sequence alignment…

A: DNA is the genetic material for many multicellular organisms. The DNA present in all organisms is…

Q: Which RNA nucleotide can pair with the Thymine (T) : antisense strand to make a pair.

A: The nucleotides in the RNA, consist of ribose sugar, carbon, and a base attached to the first…

Q: Transcriplioh nie For cuch of the following sequences, fill in either the DNA, the mRNA sequence,…

A: Synthesis of m RNA Sandhya and RNA transcription and synthesis of amino acids linked together by…

Q: 2. What polypeptide will be created from the following strand of DNA? DNA A T. T A C A C MRNA AA

A:

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The DNA sequence shown below is for a very short gene with no introns. What is the mRNA sequence for…

A: mRNA Accounts for about 5%of the total RNA in the cell . Most heterogeneous of the three types of…

Q: 2. What are IC TArE Codon marks theste at wNch translati PART D. Directions: Identify the mutated…

A: In the given question the normal DNA is TAC-CCC- GTC- ACC- GCC- TAT-ATC. The normal RNA formed from…

Q: What is the codon for the MRNA? DNA coding strand bases messenger RNA non-coding strand

A: There are four bases Adenine(A), Guanine(G), Cytosine(C), Uracil(C).

Q: 63 What is the mRNA transcribed from the template strand of DNA shown below? 5' TATGGC 3' Select an…

A: The given template strand is 5' TATGGC 3'

Q: Transcribe the given DNA sequences to mRNA. DNA: 5'-CGCCTAG-3' mRNA: 3'- DNA: 5'-AATGCGATT-3' mRNA:…

A: Both DNA and mRNA are nucleic acids that are required for gene expression and protein synthesis. DNA…

Q: The schematic diagram below shows the functional organization of transcribing RNA polymerase. Match…

A: Transcription is the next step after replication in the central dogma of biology. It is the process…

Q: DNA sense or template DNA sense or template mRNA tRNA protein 5', 3' amino or carboxyl 5' T U A A RG…

A: The genetic information for protein synthesis is stored in DNA. DNA is double-stranded. The…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: Now you will translate the amino acid sequence for the given tRNA strand. Remember that codons are 3…

A: According to Bartleby guidelines,  we are supposed to answer first three subparts in case of…

Q: 11. The template DNA for the beginning a gene is 3' – GATACATGAGGCGATACG – 5'. What mRNA transcript…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: 8. Determine the amino acid chain coded for by the following another A is added after the first…

A: Mutations are the changes in the DNA sequence that may lead to harmful results.Frameshift mutations…

Q: C T 3 11 G 5 A Hius) DNA coding (information) strand DNA template strand Synthesis of mRNA…

A: DNA stands for deoxyribonucleic acid, is a hereditary material, consisting of information related to…

Q: Which is the coding strand? Which is the template strand? What is the direction of mRNA…

A: The process of synthesizing a messenger RNA (mRNA) molecule from a DNA template is known as mRNA…

Q: EcoRI Sacl Kpnl Aval ampR Xmal Smal lacZ BamHI Xbal Sall Accl HinclI Pstl Sphl HindIII Bam H1 Bam H1…

A: Answer :- Option (C) is correct. - 1. :-

Q: Type of Point Frameshift mutation Substitution Insertion or Deletion 10 (Circle one.) How did the…

A: Nucleus is chief controller of cell in which genetic information is safely stored . It exhibit long…

Q: he question with gene sequence to predict amino acid sequence.

A: introduction  Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: TRANSCRIPTION Unzipped Single Strand of DNA Messenger RNA

A: Deoxyribonucleic acid (DNA) is the genetic material that contains the instructions for the growth,…

Q: 4. The sequence of base triplets on the coding strand DNA molecule is TGACCGTTAGCG. Which of the…

A: The genetic code is sometimes referred to as a "blueprint" since it provides the instructions that a…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: 3’-T A C G G A C T G A C G A T C-5’ What is its Complementary DNA sequence? mRNA sequence…

A: The term mutation refers to the change of DNA sequence which occurs either due to errors in DNA…

Q: 9. Which of the following statements about gene regulation is not true? ORNA interference is the…

A: The processes that regulate how genes are expressed in cells are referred to as gene regulation. It…

Q: ACA www GAC GGG TTA CC AAG GTT TAG ATC ТАС Coding strand-DNA Template strand-DNA MRNA-codons…

A: * DNA consists of four nucleotides They are  Adenine  Guanine Thymine Cytosine *RNA consists of…

Q: Which of the following molecules|are involved in gene expression? Choose all that apply. O RNA…

A: Nucleic acid such as DNA is the major carrier for genetic information in almost all living…

Q: The anticodon sequence created from the following DNA: TACGGGGCTGAGATT Select one: O a.…

A: The sequence of nucleotides that complement codons is known as an anticodon. They are found in tRNAs…