In the space provided, write the polypeptide sequence obtained from the translation of the black allele gene. Second Letter Phe UCU UCC UCA UCG Tyr UUU U UUC UUA UUG UAU UAC UAA UAG UGU UGC UGA Stop A UGG Ser Stop Stop Leu Trp CGU CC CUU C CUC CUA CUG CCU Leu | ccc CCA CCG CAU CAC CAA CAG His C Arg CGA CGG Pro Gin 1st 3rd letter letter AAU AAC AAA AAG AGU AGC AGA AGG Asn Ser ACU ACC AUU A AUC AUA AUG lle Thr ACA Lys Arg Met ACG GAU GAC GAA GAG Asp GUU G GUC GUA GUG GCU GCC GCA GCG GGU GGC Gly GGA GGG Val Ala Glu UCACUCACUCAC UCAC

Q: Draw a model of DNA. Be sure to include the names of the nitrogenous bases. thank you

A: DNA is a double helical structure that consist of nucleotides. Nucleotides consist of nitrogenous…

Q: This is a homework question that I have on my Adv. Anatomy & Physiology assignment. How to I got…

A: The hypothetical protein considered here consists of the amino acid sequence arginine,…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: Complete the table. For the polypeptide, use the three-letter code. Note: Reference the Genetic code…

A: Genetic code table basis:Reference:…

Q: Describe how two protein sequences are aligned, and how one can determine whether that alignment is…

A: Sequence alignment is a way of arranging protein sequences to identify regions of similarity that…

Q: Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point…

A: When a point mutation occurs, one of three things may happen:Due to the mutation occurring in a…

Q: if you know the amino acid sequence of a protein can you predict with 100% certainty the DNA…

A: Codon is the genetic code that is formed by permutations and combinations of three nucleotide…

Q: How can biologists explain the fact that there are 61 mRNA codons that specify an amino acid, but…

A: Introduction: The mRNA codons are read while translation, starting with a start codon and remaining…

Q: describe insertion sequences

A: DNA is the information centre for most organisms. DNA is made up of a long chain of nucleotide base…

Q: Given an artificial mRNA consisting of a repeated dinucleotide (5'... GUGUGUGUGUGU... 3), match the…

A: A codon is a group of three DNA or RNA nucleotides that codes for a particular amino acid or protein…

Q: The phrases or terms below describe different fundamental processes of nucleic acids. Sort each…

A: The process of protein synthesis involves three main stages: replication, transcription, and…

Q: Give typing answer with explanation and conclusion  Which of the triplets below is a possible…

A: Production of protein from the mRNA is known as translation in which tRNA is responsible for…

Q: rRNA sequence analysis: c. Other than RNA sequence, what other sequence can be determined by this…

A: RNA sequence analysis is used to find the sequence of nucleotide base pairs on the RNA strand.

Q: Experiments have demonstrated that the "words" of the genetic code (the units that specify amino…

A: The genetic code is a set of rules that specifies how the information in DNA and RNA molecules is…

Q: ATGGAGAAGGGACCTGGCCCACAACTTTATCCGGCGACAATAACAACCACTAACCCGTCO…

A: When DNA is synthesized into m RNA the process is called transcription and when m RNA translates…

Q: Describe how proteins are sequenced, and explain why sequence determination is important

A: Protein sequencing is the technique to determine the amino acid sequence of a protein. Proteins are…

Q: Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…

A: Codons are three nucleotide sequences on an mRNA that code for specific amino acids during the…

Q: Take the following DNA sequence and use it for protein synthesis. 3' AACGGTCCTATATACCC 5' What is…

A: DNA to Protein Synthesis: This process is based on the central dogma of molecular biology, which…

Q: Is the answer mRNA or Exon?

A: The following are further details about  each option: Exons:Incorrect.Exons are the coding regions…

Q: If a sequence of DNA has 20% Guanine bases how many Adenines would it have? Select one: O a. 10% O…

A: If a sequence of DNA has 20% Guanine bases, then it would have 30% Adenine.   Hence, option (c) is…

Q: Draw out the molecular structure of a double stranded DNA molecule. This molecule is 6 bp in size.…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Explain why the overlap between individual DNA sequences is required to reconstruct the sequence of…

A: Deoxyribonucleic acid or DNA is a molecule that contains the genetic code of the organisms. DNA…