pls help me to answer this Now you will translate the amino acid sequence for the given tRNA strand. Remember thatcodons are 3 base pairs long.17. AUG CAC UGU CCU UUC GCU GAC18. GAG AUC UGG UUG GAA UCG19. AGC GUA UUA ACG UAU CAU20. AGU CGA UCG AUG CGG AUG AUA21. GUC GUC GAU AGC UAU CAU GCATranscribe the following DNA strand. Then translate the tRNA strand you wrote.22. TGAGTCGACTGGCTGACCGTAGAC23. СтTGGCTTATGGTGGTTCGCTссThe following are pieces of mRNA. Give the DNA strand from which it was transcribed.24. GAGAUCUGGUUGGAAUCG25. AGCGUAUUAACGUAUCAUComplete the table below showing the sequences of DNA, MRNA codons, tRNA anticodonsand the amino acids. Remember the genetic code is based on mRNA codons.DNAGATMRNA codon5.UAUIRNA anticodon7.8.9.UUCAmino AcidTryptophan10.11.12.1. Using the following piece of DNA, give the MRNA molecule and the amino acidsequence for which it codes.DNA- ATATAAACGAGGAAATTCCGGGC GMRNAIRNAAmino acids:2. Use the mRNA sequence to find the DNA sequence and the amino acid sequence.DNAMRNA- AUGCCUACAUGUGGUGUAACC UATRNAAmino acidsFor each codon below, give the tRNA anticodon.3. UUC4. AUC5. CCG6. CGU7. Give all the possible Anti-codons for the amino acids listed below.Histidine (His)Isoleucine (lle)Arginine (Arg)Tryptophan (Trp)

Name: pls help me to answer this Now you will translate the amino acid seque
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: pls help me to answer this Now you will translate the amino acid sequence for the given tRNA strand. Remember thatcodons are 3 base pairs long.17. AUG CAC UGU CCU UUC GCU GAC18. GAG AUC UGG UUG GAA UCG19. AGC GUA UUA ACG UAU CAU20. AGU CGA UCG AUG CG