EcoRI Sacl Kpnl Aval ampR Xmal Smal lacZ BamHI Xbal Sall Accl HinclI Pstl Sphl HindIII Bam H1 Bam H1 Bam H1 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can be inserted into the vector cut with BamH1 and Sma 1 maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? O 2 01 O 4

EcoRI Sacl Kpnl Aval ampR Xmal Smal lacZ BamHI Xbal Sall Accl HinclI Pstl Sphl HindIII Bam H1 Bam H1 Bam H1 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can be inserted into the vector cut with BamH1 and Sma 1 maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? O 2 01 O 4

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Similar questions

What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome c. Proteome d. Metabolome e. Fluxome
Fig 3.16 EcoRI SacI KpnI |ampR Aval Xmal Smal lacZ BamHI Xbal SalI Accl HincII PstI Sphl HindIII Bam H1 Bam H1 Bam H1 1 2 3 4 The ends of the double-stranded DNA fragment above are blunt ends. The directionality of genes contained within the fragment is from left to right (arrow). After digestion by BamH1, which fragment can be inserted into the vector cut with BamH1 and Sma 1 maintaining the same directionality as the lacz promoter (green segment with arrow on vector)? 3 O 4 O1 2
BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.
Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
smolA eno DNA -- THE DOUBLE HELIX (modified from The Biology Corner - Worksheets and Lessons) The nucleus is a small spherical, dense body in a cell. It is called the "control center" because it controls all the activities of the cell. Chromosomes, found in the nucleus, are microscopic, threadlike strands composed of the chemical DNA (short for deoxyribonucleic acid). Chromosomes are composed of genes, which is a segment of DNA that codes for a particular protein which in turn codes for a trait. It is commonly referred to as the gene for baldness or the gene for blue eyes. In 1953, James Watson and Francis Crick established the structure of DNA. The shape of DNA is a double helix, which is like a twisted ladder. The sides of the ladder are made of alternating sugar and phosphate molecules. The sugar is deoxyribose. Color all the phosphates red (labeled with a "p"). Color all the deoxyriboses blue (labeled with a "D"). The rungs of the ladder are pairs of 4 types of nitrogen bases. The…
Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgtc-5 The diagram above shows an RNA primer hydrogen-bonded to a DNA template. Which letter indicates the site where DNA polymerase would add nucleotides to this structure? OA OB D Any of these is possible C
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer