What are the functional consequences of this deletion for lilP mRNA transcription and translation? (100 words max.)

Q: How is the mRNA strand altered during mRNA processing (the intermediate step between transcription…

A: DNA is the genetic material of individuals which undergoes replication, then forms RNA through the…

Q: During MRNA splicing... intron-exon boundaries are marked by exon junction complexes. the 5' cap and…

A: mRNA splicing is a process in which a newly-made precursor mRNA transcript gets converted into a…

Q: TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype

A: Transcription is the process which produces mRNA from DNA by the action of RNA polymerase.…

Q: What is the estimated speed of translation of human? Please give reasonable explaining and provide…

A: The translation is the process of protein synthesis which occurs in the ribosomes. It takes place…

Q: Transcriptionally active chromatin are generally found near the outer regions of the nucleus near…

A: The distribution of transcriptionally active chromatin throughout the nucleus is a complicated and…

Q: Why are misfolded proteins a potential problem for the eukaryotic cell, and how do cells combat the…

A: Eukaryotic cells can be defined as the cells that are complex in terms of structure and function as…

Q: Is fadh2 an enzyme?

A: A cofactor is characterized by a non-protein chemical compound or metallic ion that is needed for an…

Q: Combinatorial control of transcription factors refers to the phenomenon that: O A) small effector…

A: Transcription is the process in which the DNA is converted into mRNA and forms the part of the…

Q: 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You…

A: A transfer RNA (tRNA) is a unique type of RNA molecule with the essential function of facilitating…

Q: the mRNA and DNA used to synthesize the polypeptide sequence shown and the nucleotides of the tRNA…

A: DNA has two strands. One is called template strand and other is called coding strand. These two…

Q: 63 What is the mRNA transcribed from the template strand of DNA shown below? 5' TATGGC 3' Select an…

A: The given template strand is 5' TATGGC 3'

Q: During transcription, how many RNA nucleotide bases would usually be encoded by a sequence of 99 DNA…

A: Transcription is the first step of making a protein from DNA instructions. The human genome is made…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: 19. For this question, you will need to use the table for the genetic codes provided on the…

A: From DNA , mRNA is formed and use DNA strand as a template. Produced mRNA goes to cytosol and…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3

A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…

Q: Explain the term splicing?

A: Genetic information in our cell is carried out from DNA to RNA and then to proteins. These proteins…

Q: Describing Functions: Building Vocabulary Skills In your own words, define each of the following in…

A: Translation process takes place in the cytoplasm of the cell. It involves tRNA, mRNA, large and…

Q: mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’  -Draw a box around the sequence where protein synthesis…

A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) When DNA changes into…

Q: True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not…

A: BASIC INFORMATION TRANSCRIPTION  It is responsible for the formation of hnRNA which has the codes…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: Compared to heterochromatin, euchromatin is O comprised of densely packed nucleosomes and with…

A: Heterochromatin is characterized as the region of the chromosome which is obscurely darkled stained…

Q: How are proteins affected if the dna code is mutated

A: When a gene mutation occurs, the nucleotides are in the wrong order. It means that coded genes are…

Q: Name the three main stages of pre-mRNA processing. Explain the importance of each of the stages of…

A: Pre-mRNA, or precursor mRNA, is an immature RNA molecule that is transcribed from a gene in the cell…

Q: Transcription occurs at a rate of about 30 nucleotides per second. is it possible to calculate the…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: function of a Src homology-3 (SH3) domain?

A: Amino acids can be defined as the building blocks that form polypeptides and ultimately proteins.…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.