Homework Help is Here – Start Your Trial Now!
Science
Biology
Given the following DNA sequence: 5'ATTGGCTGTTAAAACCGGTGCCTGGGCATCGTTGGA3' Part A Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. First position (5'end) U с A G U UUU Phe UUC Phe UUA Leu UUG Leu CỰU Leu CUC Leu CỦA LHU. CUC Leu. FL F GUU Val GUC Val GUA Val GUG Val Nonpolar AUU lle AUC lle AUA lle AUG Met M -L -V UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala Polar Second position -P A A UAU Tyr UAC Tyr UAA Stop UAG Stop CAU His CAC His CAA Gin CAG Gin chicchichch AAU Asn AAC Asn, AAA Lys AAG Lys GAU Asp GAC Asp Basic GAA Glu GAG Glu Y H -Q N -K D E G UGC Cys UGA Step UGG Trp CGU Arg CGC Arg CGA Arg CGG Arg. AGU Ser AGC Ser AGA Arg AGG Arg J GGU Gly GGC Gly GGA Gly GGG Gly Acidic C W -R -R -G Third position (3'end) DURO с DURO A G U с U с A G Stop codon

Given the following DNA sequence: 5'ATTGGCTGTTAAAACCGGTGCCTGGGCATCGTTGGA3' Part A Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. First position (5'end) U с A G U UUU Phe UUC Phe UUA Leu UUG Leu CỰU Leu CUC Leu CỦA LHU. CUC Leu. FL F GUU Val GUC Val GUA Val GUG Val Nonpolar AUU lle AUC lle AUA lle AUG Met M -L -V UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala Polar Second position -P A A UAU Tyr UAC Tyr UAA Stop UAG Stop CAU His CAC His CAA Gin CAG Gin chicchichch AAU Asn AAC Asn, AAA Lys AAG Lys GAU Asp GAC Asp Basic GAA Glu GAG Glu Y H -Q N -K D E G UGC Cys UGA Step UGG Trp CGU Arg CGC Arg CGA Arg CGG Arg. AGU Ser AGC Ser AGA Arg AGG Arg J GGU Gly GGC Gly GGA Gly GGG Gly Acidic C W -R -R -G Third position (3'end) DURO с DURO A G U с U с A G Stop codon

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question

Give typed explanation 

Given the following DNA sequence: 5'ATTGGCTGTTAAAACCGGTGCCTGGGCATCGTTGGA3' Part A Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. First position: (5'end) U с A G U UUU Phe UUC Phe UUA Leu UUG Leu -F CỰU LAU CUC Leu CỦA LU CUỘ Leu. GUU Val GUC Val AUU lle AUC lle AUA lle AUG Met M GUA Val GUG Val Nonpolar -L FL -V с UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala Polar Second position S -P -A UAU Tyr UAC Tyr UAA Stop UAG Stop CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu Basic Y H Q N K D E G UGU UGC Cys UGA Stop UGG Trp AGU Ser AGC Ser AGA Arg AGG Arg Acidic CGU Arg CGC Arg-R CGA Arg CGG Arg GGU Gly GGC Gly GGA Gly GGG Gly W -S -R G Third position (3'end) DUA с G DUMO с A G DUACIDUNG А Stop codon
Transcribed Image Text:Given the following DNA sequence: 5'ATTGGCTGTTAAAACCGGTGCCTGGGCATCGTTGGA3' Part A Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. First position: (5'end) U с A G U UUU Phe UUC Phe UUA Leu UUG Leu -F CỰU LAU CUC Leu CỦA LU CUỘ Leu. GUU Val GUC Val AUU lle AUC lle AUA lle AUG Met M GUA Val GUG Val Nonpolar -L FL -V с UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala Polar Second position S -P -A UAU Tyr UAC Tyr UAA Stop UAG Stop CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu Basic Y H Q N K D E G UGU UGC Cys UGA Stop UGG Trp AGU Ser AGC Ser AGA Arg AGG Arg Acidic CGU Arg CGC Arg-R CGA Arg CGG Arg GGU Gly GGC Gly GGA Gly GGG Gly W -S -R G Third position (3'end) DUA с G DUMO с A G DUACIDUNG А Stop codon
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 3 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS