Translate the protein that is expressed from this template DNA sequence. Transcription is going left to right, the intron is underlined. Codon table is provided. 3' ATCATGACCTACAGGCAGATGATTATAGACCCTGACATTTATTTGGCG 5'
Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…
A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…
Q: . List the sequences of RNA that would be transcribed template sequences. a. Ans:…
A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…
Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is
A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a) 5’…
Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…
A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: b) What is the MRNA sequence that would be created from the DNA template sequence above?…
A: Cell is the basic structural and functional unit of life. All the cells contains the nucleus with…
Q: Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU…
A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…
Q: E 64 In the figure shown below, which of the DNA strands is the template strand, upper or lower?…
A: Ans- The template strand of the DNA serves as a template for synthesis of a complementary RNA…
Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence
A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…
Q: Directions: Transcribe the DNA sequence in the space provided. Use your notes and what you know.…
A: Transcription A process of making of mRNA from DNA. mRNA contain information about polypeptide…
Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…
A: Gene expression is the process by which the instructions in the DNA are converted to functional…
Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…
A: The RNA is produced from the template strand of DNA by the transcription process that occurs within…
Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…
A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…
Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…
A: The process of gene expression involves the process of transcription followed by the process of…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…
Q: On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and…
A: The DNA is transcribed into mRNA by the process of transcription and this mRNA is translated into…
Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…
A:
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…
A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…
Q: Which is the DNA template given if the MRNA O 3- GCCTACGGGCATATGGTA -5 JACGUA -3
A: During transcription mRNA is generated from DNA by the process called transcription .and then this…
Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. What is the…
A: A DNA sequence is transcribed to produce messenger RNA (mRNA) which is a link between DNA and…
Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…
A: The process of protein synthesis using the information in an organism's DNA is called central dogma…
Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…
A: Proteins are defined as polymers of amino acids. As there are 22 standard alpha-amino acids by which…
Q: Use the codon wheel on page 10.11 to identify any stop codons in the stop codons. Use the codon…
A: During transcription process RNA is formed with the help of complementary base pairing with template…
Q: During initiation of translation, a is positioned first at the…
A: The translation is the process of synthesis of proteins that occurs on the ribosomes in the…
Q: 3’-TCTTCGTGAGATGATATAAGAGTTATCCAGGTACCGGTAAACTGG-5’…
A: The process of copying the information in a strand of DNA to produce an mRNA is called…
Q: From TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC. Translate the mRNA sequence.
A: The givem template sequence is as follows, TAC CTA CTC TAG TTA ACC ACA GTT GCC ATC Template strand…
Q: PART C. Use your codon chart to determine the amino acid sequence. Remember to read through the…
A: the three-letter genetic code is the way by which the cell transcript the information from DNA to…
Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon…
A: A mutation is a permanent and heritable change in the nucleotide sequence of the DNA of an organism…
Q: If the promoter is here and transcription starts here…
A: Transcription is the process of formation of RNA using DNA as a template.
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of…
A: Transcription is the process by which the information in a DNA strand (template) is copied into a…
Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…
A: Protein consists of amino acids linked by amide bonds or peptide bonds.
Q: Need help to answer the following questions. Not sure if my answers are right.
A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…
Q: Given the following DNA sequence from the template strand of a given gene:…
A: Codon is a sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Given is a DNA template with a sequence and it consists of two exons and introns in it.Exons are the…
Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…
A: The given DNA sequence is as follows, TGC GTG TAC CTA CCA
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation of m RNA to peptides occurs in the ribosomes. there are three different sites…
Q: Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: The following DNA strand is bound to transcription and translation. Give the translated 5-letter…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotide…
Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC
A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…
Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…
A: Transcription Formation of RNA over DNA template is called transcription. Translation The process…
Q: summarize these results using concise language in a neat table; Control : 5’…
A: There are different types of mutations based on the changes in DNA sequences. It includes missense,…
Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…
A: AAG ATA CAG GCT CGG TAA : DNA
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: Translation is the process of formation of protein from mRNA As in the question above start codon is…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…
Q: A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of…
A: A mutation is an abnormal change in DNA sequences that alters the protein product and is one of the…
Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…
A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…
Q: Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation…
A: The start codon for eukaryotes is methionine. There are different initiation codons for different…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GmRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
- On the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Below is a sequence of DNA.5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF? How many codons are in the longest ORF? What is the frame of the shortest ORF? How many AA are in the shortest ORF? Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortestORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longestORF (from N to C-terminal end)?
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleThe sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
- Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to 330. Transcription starts at the Transcription Start Site (TSS) that is the base located at position 57. -55 5' AATAAСTTGAGATTTTGATTGACАТССТТСТСАCAGAGCCTATAATACCТАТТТС 3' 3'TТАТTGAACTСТААААСТААСТGTAGCAACAGTGTCТСGGATATTATGGATAAAG 5' 56- 5' ТACGTATAGAСАСТСAGAGGAAAGACAGAGAGAGAGTTAGCATTGTACTАТСТСТ 3' 3' АTGCATATСТсTGAGTCTCCTTтстстстстстсТСААТСGTAACATGATAGAGA 5' 65- -105 --110 -140- 5' СТTTTAGATATATCTCТАТСТСТСТСАСТССАТСТТТСТCGTGTTAACACAAСА 3' 3' GAAAATCTATАTAGAGATAGAGAGAAGTGAGGTAGAAAGAGCACAAТТСTСТTGT 5' 111- -120- -130- -150- -160----165 166- --175- --185- -195 -205- -215-----220 ------- 5' GTCACAGACTCACAGATCTTTGTCGGTGATCGGAGATGGAGTTCCGGGAGAAGCT 3' 3' CAGTGTCTGAGTGTCТAGAAACAGCCACTАGССТСТАССТСААGGCCCTСТТCGA 5' 221- -230- 240 -250 -260 -270-----275 5' TTATAAGTTCAAGTTGCAATAGGTGTTTGCCTTTGTTTTATCTCTCCTCACCGTA 3' 3'ААТАТТСААGTTCAACGTTATCCАCAAACGGAAACAAAАТAGAGAGGAGTGGCAT 5' 276- -285- -295- -305 -315…If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.