First LetterAGUс22. Using the provided "Genetic Code-Reference" answer the following question.Based on the following DNA template strand, write out the amino acid chain produced.23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "GeneticCode-Reference".Genetic Code-ReferenceUUUUUCUUAUUGCUUCUCCUACUG(mutated or silent)(mutated or silent)b. Briefly explain your reasoning for each. (be sure to include both parts)AULLYAUUa. Label which of the following would result in a mutated amino acid sequence or a silentmutation. (May help to first determine the original amino acid sequence, then compareto mutations)UPhemRNA codon sequence:anticodon sequence:amino acid sequence:LeuLeu5'-AUA-GAA-3'Val5'- AUC-GAC-3'AUC IlleAUAAUAJ*AUG Met/StartGUUGUCGUAGUGUCUUCCUCAUCG)CCU)CCCcccCCA000CCGACUACUACCACAACG,CGCUGCCGCAGCGSecond LetterSerProThr3'-CAA-GTC-TGT-5'AlaUAUUAC) TyrТугA**UAA StopUAG StopCAU]CACJCAACAG/GinGAUGACGAAGAGAAU AstAAC)AAA]AAG/Lys>HisAspGluGUGUUGC Cys**UGA StopUGG TrpCGUCGCCGACGGArgAGUAGCAGA]AGG ArgGGUGGCGGAGGGSerGlyThird LetterUс сAGUсAAG11UCAGUCAG

Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Answered: 22. Using the provided "Genetic…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde / Human DNA sequence ATG TGT CCA TTA ACG TGC ACA Name the codon that is formed from base triplet number 2 on the DNA sequence. Write down the names of the amino acids coded for by base triplets 6 and 7. Write down the full names Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following: the amino terminus (N) the carboxyl terminus (C) a peptide bond an α-carbon atom If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed? E.The following is a sequence of base triplets in DNA F.If guanine, found in the first base…
1. The nontemplate strand of a segment of double- helical DNA contains the sequence: (5')CGCTATAGCGTTTAG (3') (a) What is the MRNA base sequence that can be transcribed from this double helical DNA assuming you already have a ready RNA polymerase present and everything else needed for RNA transcription? Label the sequence ends and list what is required for RNA Pol to work. (b) What amino acid sequence could be coded by the mRNA in (a)'s answer assuming the AUG start codon is just upstream of the MRNA (not shown in the sequence provided)? Use table in Figure 27-7 of the Lehninger 7 th ed "Dictionary of amino acid code words in mRNAs" and write the peptide according to standard convention with abbreviations for the amino acids. (c) If the wrong strand was transcribed and then translated from the section of double stranded DNA shown above, what would the resulting amino acid sequence be? What would the MRNA sequence be? Explain your answer and label all strands. 歐歐队相阳阳一即即的 9 First letter…
1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?
28)
1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
13. please answer, i'll give thumbs up
36.Start with two exons and an intervening intron. Include the cap and poly-A tail in your starting pre-mRNA. Show 2’-OH, 3’-OH, O-P-O phosphodiester bonds for the two transesterification reactions that splice exon 1 and exon 2. Be sure to include the branchpoint A and intron consensus sequences. You will need to show where the incoming -OH attacks the O-P-O bond to allow correct splicing in the lariat and between exons. Make your arrows precise. Show the lariat with the consensus sequences. Whenever possible, show 5’ and 3’ ends. Explain the fate of the lariat after it forms?
20. TRNA stands for transfer RNA, since a tRNA molecule transfers an amino acid to the growing protein molecule. You could also think of tRNA as translation RNA. Explain how tRNA molecules help the ribosome to translate the sequence.of nucleotides in mRNA to i sequence of amino acids in a protein. To see the process of translation in action, watch "Translation" at https://www.biointeractive.org/classroom-resources/translation-basic-detail. 21a. Fill in the blanks to label each type of molecule in this figure. a.tRNA $ & 7 8 9.
1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS