Refer to a genetic code table for the question. below is a portion of the template strand of a particular gene sequence. Which of the following would be the correct sequence of amino acids in the protein that this portion of the gene encodes? (Note that there are no entrance in this gene sequence, and this portion is found in the middle of the coding sequence, past the start codon, so you should transcribe and translate the entire portion of this sequence)  template DNA : 3' - ACG GGT TCC TTT AAC GCG TAG -5'  A) Thr-Gly-Ser-Phe-Asn-Ala B) Cys-Pro-Arg-Lys-Leu-Arg-Ile C) there is not enough information given to determine the amino acid sequence of this portion of the gene

Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…

A: As per the bartleby guidelines experts are allowed to answer only 3 sub-parts for a question. The…

Q: physical defense 4. What component of the human epidermis functions to make the skin's surface…

A: Immunity is the ability of an organism to fight against disease causing agents.

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: Which of the following expalins why folate is critical to the health of a newly conceived embryo?…

A: Folate is required for the formation of great healthy cells as well as DNA and RNA in the growing…

Q: The enzymatic activity of the DNase I variants was tested using a DNA hyperchromicity assay. The…

A: Enzymes are proteinaceous entities responsible for carrying out as well as boosting the overall rate…

Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…

A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Consider this list (below) of steps involved in translation. These steps are out of order.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…

Q: The gene ABCD is 1500 bases long.  Answer the following questions:   What would be the likely…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Mutation is the sudden change in the base pair of sequence resulting in altered phenotype. The…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: Write the sequence of a different six nucleotide palindromic DNA sequence that uses all four…

A: Palindromic DNA sequences are read the same on both DNA strands from the similar end. For example,…

Q: The following DNA fragment was isolated from the beginning of a gene. Determine which strand is…

A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions necessary for the…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Which is the coding strand? Which is the template strand? What is the direction of mRNA…

A: The process of synthesizing a messenger RNA (mRNA) molecule from a DNA template is known as mRNA…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…

A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…

Q: Which of the following statements about nutrient inputs and eutrophication is FALSE? O Fossil fuel…

A: Eutrophication is the process of enrichment of an aquatic ecosystem with excess plant…

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: Where and for what reason (s) are you likely to observe the letter "N" in your Sanger sequence…

A: Sanger sequencing, also known as chain-termination sequencing, is a method for determining the…

Q: Consider the following DNA sequence, which codes for a short polypeptide:…

A: A codon is a sequence of three nucleotides (in DNA or mRNA) that specifies a particular amino acid…