PLEASE HELPP Second base of codonCThree-letterUUU)PheUUCSUCUCUThree-letterabbreviationUAUAmino acidUGUTyrUGCOUGAUabbreviation Amino acidUACUUAUCAalanineAlaleucineLeuUAALeuUUGJUCGUGGarginineArglysineUAGTrpCGULysCUUCUCAUasparagineAsnmethionineMetCUCLeuCAC HisCGCArgProCUACCACAACGAaspartic acid Aspphenylalanine PheCAG GihCGGCUGCGcysteineCysprolineProAUUACUAAUAGUAsnSerglutamic acid GluAUC le ACCThrACAserineSerAAC JAGCSAUAAAAglutamineAGAArgGlnthreonineThrAUG Met ACGAAG SLYSAGGJGUUGCUglycineGlytryptophanTrpGGUAspGGCGlyGGAGluGAUUGUCGCCGAChistidineHistyrosineTyrGUAValGCAGAAAisoleucinellevalineValGUGGCGGAGGGG1. What nitrogenous base is found in position Y?2. What nitrogenous base is found in position X?3. What amino acid is in the position labelled W?MacBook Air吕口F3000F4F5F6F7F8F9F102$*4.56一78RYUPThird base of codon皇 | 多|ミ品| 長First base of codon The tables below represent a portion of a DNA molecule and its corresponding MRNA, TRNA, andpolypeptide chaln. Some information has been omitted deliberately.CDNA:CAGMRNA:UUTRNA:CAAminoacids:TryptophanSecond base of codonUCThree-letterabbreviation Amino acidThree-letterUUUCUUAUUGUUGCUGAPheTyrCysUAmino acidabbreviationUACSerUAAUAGUUCJUCCCUUAUCAalanineAlaleucineLeuALeuUUGSUCGUGGTrparginineArglysineLysCUUCCUCAUHisCACCGUasparagineAsnmethionineMetCUCLeuCCArgProCUAССАCAACGAaspartic acid Aspphenylalanine Phe-GinCUGCGCAGCGcysteineCysprolineProAUUAUC lle ACCACUAAUAGUUAsnglutamic acid GluserineSerAACAGCThrAUAACAAGAArgglutamineAAAAGinthreonineThrAUG Met ACGLysAGGGGUAAGglycineGlytryptophanTrpGUUGUCGCUGAUGAC CAsphistidineGCCGGCHistyrosineTyrMacBook AirO0OO00F4F3IIF8F5F6F7F9F102$&*4.78RYPThird base of codon5是 |First base of codon

Nucleotides are the building blocks of DNA and RNA. The process of transcription produces messenger…

Answered: 1. What nitrogenous base is found in…

1. What nitrogenous base is found in position Y? 2. What nitrogenous base is found in position X? 3. What amino acid is in the position labelled W?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
FIRST BASE UUU- UUC UUA UUG U CUU- CUC -Phe -Leu DNA Sequence tRNA Sequence (anticodon) -Leu CUA CUG AUU- ACU AUC lle ACC AUA ACA Met or AUG Start ACG- GUU GUC GUA GUG mRNA Sequence (codon) AMINO ACID Sequence SECOND BASE C -Val UCU- UCC UCA UCG- CCU CCC CCA CCG GCU GCC GCA GCG Ser -Pro Thr Ala AAG GAU UAU Cys UAC UAA Stop UGA Stop UAG Stop UGG Trp CAU- CGU -His CAC CGC CAA CGA -Gin CAG CGG AAU- AGU- AAC- AGC AAA- AGA AGG GGU- ASP GGC GGA GGG GAC- GAA GAG UGU- Tyr UGC- Asn Lys G Glu Arg 2 1. In your bag is a specific DNA sequence. 2. Copy that sequence in the box below labeled DNA sequence 3. Transcribe the sequence in the appropriate box. 30 Ser 4. Determine the appropriate anticodon sequence. 5. Translate the appropriate sequence into an amino acid sequence using the codon chart above 6. Using the contents of the bag, create your protein. Arg Gly THIRD BASE
please help
If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
can someone help
Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First Position
Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the table below. DNA triplet mRNA codon tRNA anticodon Amino Acid AAG GGC CAG UUA AAA GTA CUC ACA TAT AGC AUU CCA GGC
The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…
Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…
For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G