Homework Help is Here – Start Your Trial Now!
Science
Biology
5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 -5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your MRNA into an amino acid sequence. Begin at the first codon. Second position Third position (3'end) First position (5'end) A. UAU Tyr UAC Tyr UAA Stop UAG Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser UUU Phe -F UUC Phe UUA Leu FL UUG Leu UCA Ser UCG Ser CGU Arg CGC Arg CAU His CCU Pro ССС Pro CCA Pro CCG Pro H. CUU Leu CAC His CAA Gln CAG Gin -R CGA Arg CGG Arg CỤC Leu A -L CUA Leu CUG Leu U AGU Ser AGC Ser AAU Asn AUU Ile AUC lle AUA lle AUG Met M ACU Thr ACC Thr ACA Thr AAC Asn. AAA Lys K. AAG Lys -- AGA Arg FR AGG Arg ACG Thr GUU Val GUC Val GCU Ala GCC Ala GAU Asp -D GAC Asp_ GGU Gly GGC Gly -V GUA Val GUG Val -A GCA Ala GCG Ala GAA Glu -E GAG Glu -G GGA Gly GGG Gly Basic Acidic Stop codon Polar Nonpolar Adapted from Dr. V. Evans

5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 -5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your MRNA into an amino acid sequence. Begin at the first codon. Second position Third position (3'end) First position (5'end) A. UAU Tyr UAC Tyr UAA Stop UAG Stop UGU Cys UGC Cys UGA Stop UGG Trp UCU Ser UCC Ser UUU Phe -F UUC Phe UUA Leu FL UUG Leu UCA Ser UCG Ser CGU Arg CGC Arg CAU His CCU Pro ССС Pro CCA Pro CCG Pro H. CUU Leu CAC His CAA Gln CAG Gin -R CGA Arg CGG Arg CỤC Leu A -L CUA Leu CUG Leu U AGU Ser AGC Ser AAU Asn AUU Ile AUC lle AUA lle AUG Met M ACU Thr ACC Thr ACA Thr AAC Asn. AAA Lys K. AAG Lys -- AGA Arg FR AGG Arg ACG Thr GUU Val GUC Val GCU Ala GCC Ala GAU Asp -D GAC Asp_ GGU Gly GGC Gly -V GUA Val GUG Val -A GCA Ala GCG Ala GAA Glu -E GAG Glu -G GGA Gly GGG Gly Basic Acidic Stop codon Polar Nonpolar Adapted from Dr. V. Evans

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question
5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E GAG Glu G Basic Acidic Stop codon Polar Nonpolar Adapted from Dr. V. Evans
Transcribed Image Text:5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E GAG Glu G Basic Acidic Stop codon Polar Nonpolar Adapted from Dr. V. Evans
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps with 1 images

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS