Question is in the image ### Practice ProblemYou use shotgun sequencing to determine a DNA sequence. For one strand, you get the following sequences out of your shotgun sequencing reaction. What is the correct order of the fragments?**Fragment 1:** 5'-CAGCAGCAGTTGG-3' **Fragment 2:** 5'-CGGCGGAAAAGC-3' **Fragment 3:** 5'-GAGGAGCGGCCGCCAGCAG-3' **Fragment 4:** 5'-TTGGATGCGGCG-3' ### Order of Fragments: 3-1-4-2The fragments are arranged as follows to reconstruct the original sequence:GAGGAGCGGCCGCCAGCAG CAGCAGCAGTTGG TTGGATGCGGCG &

"Shotgun sequencing" is a technique for determining an organism's nucleotide sequence by sequencing tiny sections of the genome. Shotgun sequencing divides the DNA from several copies of a chromosome into fragments.Answer: Order of fragments: 3-1-4-2 GAGGAGCGCCGCCAGCAG CAGCAGCAGTTGG TTGGATGCGGCGG CGGCGGAAAAGC Final sequence: GAGGAGCGCCGCCAGCAGCAGCAGTTGGATGCGGCGGCGGAAAAGC During the Shotgun procedure, Short pieces of sequenced DNA were created. These tiny segments of sequenced DNA were assembled by overlapping them, and then one appropriate sequence was created. Therefore after overlapping, we got this sequence GAGGAGCGCCGCCAGCAGCAGCAGTTGGATGCGGCGGCGGAAAAGC.Conclusion: The pieces are introduced onto plasmids before being cloned in bacteria. Plasmid DNA is extracted, purified, and sequenced from bacteria. Finally, a computer assembles the fragment sequences into a continuous sequence of the whole chromosome based on fragment overlap. Thus, Bioinformatics is the study of using computers to understand gene function.