One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. 5'- What special type of sequence is contained in this DNA segment? O Hoogsteen pairing major groove O palindrome mirror repeat What alternative structure does the double-stranded DNA have the potential to form? B-DNA a G tetraplex triplex DNA a cruciform Z-form DNA
Nucleotides
It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).
Nucleic Acids
Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.
![**DNA Complementary Strand Exercise**
One strand of a double-helical DNA has the sequence 5’–GCGCAATATTTCTCAAATATTCGCC–3’.
**Task:** Write the base sequence of the complementary strand.
**Complementary Strand:**
5’ – [Input Box] – 3’
---
**Question:** What special type of sequence is contained in this DNA segment?
- ○ Hoogsteen pairing
- ○ major groove
- ○ palindrome
- ○ mirror repeat
---
**Question:** What alternative structure does the double-stranded DNA have the potential to form?
- ○ B-DNA
- ○ a G tetraplex
- ○ triplex DNA
- ○ a cruciform
- ○ Z-form DNA
---
**Instructions for Educators:**
- Discuss the principles of base pairing (A with T, G with C).
- Explore DNA structural features and unique sequence types.
- Explain potential alternative DNA structures and their biological significance.](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fd78d7eb9-50c8-478a-83b9-25d69edc6dbe%2F34f0f892-640e-471e-b1b7-7fad92b02a15%2Fuuptfy8_processed.png&w=3840&q=75)
Step by step
Solved in 4 steps
