PhosphateTSugarGGA4BasesO CCCACTTGAGGAGTTCACCCGGGTGAACTCCTCAAGTGGGO None of the AboveSuppose the DNA molecule shown at left was produced in the test tubefrom deoxynucleotide 5'-triphosphates.What is the correct primary sequence of this piece of DNA?

Nucleic acids are biomolecules that store genetic information and help pass it from one generation…

Answered: Phosphate Sugar G A Bases O CCCACTTGAG…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

47. Is the following a polymer of DNA or RNA? Explain how you can determine this. (Give two pieces of evidence). Label 3' and 5' ends. was CH₂ H 4 H 0 OUP-O 00 \5' 4 H H OH CH₂ H 3₁ 7 N S N 1' H 0 0=P-Q 4 5 H H- CH₂ OH H H 0=P-0₁ guanine NH ₂ N-H H OH uracil NH₂ H cytosine 04 03
Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’
a) It is known that double stranded DNA is denatured at low pH. pKa values should allow the determination of whether this is due to perturbation of the hydrogen bonding in A-T and/or G-C base pairs. The table gives values for the pKas of different protonated groups in the nucleobases.Nucleobase Position & pKa A N1, 3.5 G N7, 1.6; N1, 9.2 C N3, 4.2 T N3, 9.7a) Draw the A-T and G-C base pairs. - Label the bases with the one-letter code. – - Number the atoms in the rings and label the atom that attaches to the sugar. - Mark the groups that interact in normal…
please dont give hand writting solution please
The two strands for the helix-shaped DNA molecule are heldtogether by electrostatic forces as shown in class. Due to electron sharing, themagnitude of the net average charge on the H and N atoms, each, is 0.2e. Thenet average charge on the C and O atoms, each, is 0.4e. The distance betweenany two adjacent atoms on the same molecule is 0.1nm. Since electric fieldsdecrease as an inverse square law, they die off quickly with distance. So, theonly fields that really contribute to any given bond are due to the 3 atomsalong the red dotted line in the class diagram (two atoms on one'molecule andone atom on the other molecule).Calculate the electric fields and net force between a thymineand an adenine pair.=Calculate the electric fields and net force between a cytosineand a guanine pair.nConsider the OHN bond in the AT nucleotide. Can theelectric field be zero anywhere along the axis of this bond? If not,explain why not. If so, find where the electric field is zero.
Table I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
It is known that double stranded DNA is denatured at low pH. pKa values should allow the determination of whether this is due to perturbation of the hydrogen bonding in A-T and/or G-C base pairs. The table gives values for the pKas of different protonated groups in the nucleobases.Nucleobase Position & pKa A N1, 3.5 G N7, 1.6; N1, 9.2 C N3, 4.2 T N3, 9.7a) Draw the A-T and G-C base pairs. - Label the bases with the one-letter code. – - Number the atoms in the rings and label the atom that attaches to the sugar. - Mark the groups that interact in normal…
All ingredients required for the synthesis of DNA were placed in a test tube. The primer has the sequence 5’-TCGATCA-3’. First determine where the primer will bind to the DNA template given below (Do this by writing the sequence of the primer on top of the template – make sure you find a location that is complementary in sequence and that the primer is antiparallel with respect to the template) and then indicate the nucleotides that DNA polymerase would attach onto the primer as it synthesizes DNA (hint: in which direction does DNA polymerase attach nucleotides onto a primer?) See figure 13.16 in book. 5’-GACGTAGTCTGATGCTAGCATGCTGATCGAAAGAG-3’
5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
Convert the words into past tense and passive voice.
1 10 5' АGT ССG A UGC 3' 8. There are inaccuracies in the DNA molecule shown here. || | | | | |||| 5 тCА GGCT АТG 3' a) Name three things that are wrong in the above DNA sequence. b) What type of chemical interaction is indicated by a "|" in the diagram? c) What happens to these interactions during DNA replication?

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS

Phosphate Sugar G A Bases O CCCACTTGAG O GAGTTCACCC O GGGTGAACTC OCTCAAGTGGG O None of the Above Suppose the DNA molecule shown at left was produced in the test tube from deoxynucleotide 5'-triphosphates. What is the correct primary sequence of this piece of DNA?