5’ TAAGCGTAACCCGCTAA   CGTATGCGAAC   GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT   GCATACGCTTG   CCCAGGATAATTGCGTG 5’   Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer

Q: 1. For the DNA molecule shown below, the 3' Strand of DNA is transcribed into mRNA and then…

A: The creation of proteins from the hereditary data stored in DNA depends on the processes of…

Q: what is the adenine content

A: In double-stranded DNA, 3 hydrogen bonds form between guanine and cytosine and make them a pair. On…

Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: For some DNAS it is possible to separate the two strands, after denaturation, in a CsCl gradient.…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Cells normally repair the lesion O-methylguanine (0°-meG) by directly transferring the methyl group…

A: Solution:This image presents a question about DNA repair, specifically the repair of…

Q: For some DNAs, it is possible to separate the two strands, after denaturation,in a CsCl gradient.(a)…

A: Denaturation is a process in which proteins or nucleic acids lose the quarternary structure,…

Q: You start with a relaxed DNA plasmid that is 1000bp in length. a). What is the starting linking…

A: Since you have posted a question with multiple sub-parts, we will solve the first sub-part for you.…

Q: The gel pattern below was produced by the Sanger sequencing method. Determine the sequence…

A: In sanger Sequencing, the products of the nucleotides A, G, C, and T reactions are individually…

Q: 1. Epigenetic marks refer to modifications to DNA and proteins that in tum regulate gene expression.…

A: Different macromolecules are present in humans. They include carbohydrates, lipids, proteins, and…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: Sequencing of the following fragment of single-stranded DNA needs to be undertaken using the Sanger…

A: Sanger sequencing, also referred to as the “chain termination method”, may be a method for…

Q: A team of scientist is interested in the amplification of a specific DNA fragment in a large plasmid…

A: The specific DNA sequence can be amplified by using primers in the polymerase chain reaction or PCR.…

Q: 7 a-d. i. ii. Draw the Hydrogen bonds between the base pairs and label the atoms that participate in…

A: There are 2 conventional base pairs in DNA. They are; Between Adenine and Thymine Between Guanine…

Q: Examination of the structure of DNA polymerases bound to nucleotide analogs reveals that conserved…

A: DNA polymerase is a member of a family of enzymes that catalyse the synthesis of DNA molecules from…

Q: EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments…

A: A restriction site or recognition site, is a specific sequence of nucleotides in DNA that a…

Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…

A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…

Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…

A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…

Q: 4b) Chargaff was the first person to isolate large strands of genomic DNA, rather than small…

A: DNA is the hereditary material in humans and almost all other organisms. Nearly every cell in a…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Q: Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing…

A: Basic structure of DNA and the structure of different nitrogenous bases.

Q: 92. You have sequenced a short piece of DNA (by chain termination sequencing) and produced the gel…

A: As we know we have to depict the sequence of any amino acid sequence transcribed from 5' end to 3'…

Q: 90. The DNA template fragment shown was sequenced by the Sanger method. A sample of the DNA was…

A:

Q: A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the…

A: DNA(Deoxy ribonucleic acid) is a double stranded helical structure which is made up of phosphate…