21:41 จ. 8 ก.ค. ... Reading assignment MD. 201 (No. 1-3) - by J.Kaulpiboon 6. Check your understanding 2 3000 bp. 1500 bp - 500 bp | |||| لی 3 A J Which lane matches each description below? This lane contains the longest DNA fragment. This lane contains the shortest DNA fragment. This lane contains a 1500 base pair (bp) DNA fragment.. ... A 33% 89% +

Q: 1. For the DNA molecule shown below, the 3' Strand of DNA is transcribed into mRNA and then…

A: The creation of proteins from the hereditary data stored in DNA depends on the processes of…

Q: E D A 11. Ligase is denoted by letter 12. The Okazaki fragment is denoted by letter . 13. The SSB…

A: DNA (Deoxyribonucleic acid) and RNA are two examples of nucleic acids (Ribonucleic acid).…

Q: 16/ The phosphates that make up the phosphodiester bonds in DNA have pKa  2. What is the sign of…

A: pKa of the phosphodiester bond in DNA = 2 It is desired to calculate the charge on DNA at neutral…

Q: continuous sequence Explain the statement. of - base

A: The sequence of bases in a portion of a DNA molecule , is called gene . It carries the instructions…

Q: How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect…

A: Before an answer is given, the process of DNA replication must be understood. First there are two…

Q: Why are some transposons medically important?

A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: 2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and…

A: In conventional sequencing method, in a reaction mixture,  single-stranded molecules of the DNA,…

Q: Cmet-leu-phe-arg-glu-glu lou-ser-tou E)met-arg-glu-arg-glu-arg 231frecall) Agarose gel…

A: DNA, or deoxyribonucleic acid, is a molecule that holds the biological instructions that distinguish…

Q: 100 50 104 1 10 104 Cot DNA renaturation curves occasionally show three distinct phases of…

A: A single stranded DNA binds to its complementary strand to reform double stranded DNA is called…

Q: 93. Which is a common function for the protein product of a cancer-causing gene? a) a role in DNA…

A: Cancer-causing genes, like the name implies are genes that lead to the development of cancer. We…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: 5' guanine cap 5' AUGCCGAUGCCUCCUAUCAGAUAAAAUAAA poly A tail AAAA 3' During DNA replication, a…

A: The mutation is the sudden and abrupt change in the structure and function of the chromosomes.

Q: 7 a-d. i. ii. Draw the Hydrogen bonds between the base pairs and label the atoms that participate in…

A: There are 2 conventional base pairs in DNA. They are; Between Adenine and Thymine Between Guanine…

Q: 1a. What do DNA polymerases need to be able to synthesize a new strand of DNA? In 1970, Fred Sanger…

A: Since there are multiple questions in this particular question, I'll answer the first one for you.…

Q: BamHI Haelll Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 How long is the original DNA molecule?

A: If it is a closed circular DNA, BamH1  cut it into three fragments of length 10kb 5kb 2kb

Q: I. A mutation that converts glutamic acid to glycine is classified as a missense mutation. II.…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: rue for Sequence tagged site (STS) markers: e mapped by fluorescence in situ hybridization (FISH)…

A: sequence-tagged site (or STS) is a short (200 to 500 base pair) DNA sequence that has a single…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: DNA ladder 1 DNA ladder 2 bp ng/Sul 10000 8000 40 40 6000 3000 40 4000 40 700 600 3000 40 500 -2000…

A: Agarose gel electrophoresis is used to separate DNA molecules.

Q: . A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′…

A: Mismatch repair : It is a system for recognizing and repairing wrong insertions, deletions and…

Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…

A: Mutations are DNA errors that occur during life. A mutation is defined as any alteration in the DNA…

Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…

A: Agarose gel electrophoresis is a method of gel electrophoresis that is used to separate a mixed…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: 5) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between…

A: DNA Polymerase and Ligase are the two classes of enzymes that take part in DNA replication and…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: 32. The molecule above is called HO O=A-0 OH OH and it can be found in A)…

A: Simple sugar and carbohydrate ribose has the chemical formula C5H10O5 and the linear form H(CHOH)4H.…

Q: . Pancreatic deoxyribonuclease I (DNase I) is a nuclease that makes single-strand nicks on…

A: The genetic material DNA is packaged in eukaryotic cells with the help of histone proteins. The DNA…

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is…

Q: (a) Provide the sequence of the DNA complementary to the following strand (please write it in the 3'…

A: Complementary DNA  Complementary DNA (cDNA) could be a DNA copy of a mRNA (mRNA) molecule created by…

Q: d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to…

A: Deoxyribonucleic acid is also known as DNA and ribonucleic acid also known as RNA are two types of…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature formula :  Tm = 4* (G+C) + 2 * (A+T)  Number of G+C = 6  Number of A+T = 20

Q: . The DNA polymerases are positioned over the following DNA segment (which is part of a much larger…

A: Introduction  DNA replication is very crucial process for the continuation of life as every new…

Q: 6. H₂C HO Which of the following dinucleotides can be methylated by DNA methyltransferase? NH₂ NH₂ 9…

A: Since you have asked multiple questions, we will answer only first question for you. In order to get…

Q: A geneticist is interested in determining the locations of methylated cytosines within a fragment of…

A: Sodium bisulfite (NaHSO3) is a potent deamination agent. It removes an amino group (-NH2) from…

Q: IK Comans Caselm) are shOwn in the following document: Codon Number Base Sequence of Normal DNA…

A: The base sequence of a normally transcribed strand is given as follows, TAC TCC CTC AAT CTT AAT TTG…