21:41 จ. 8 ก.ค. ... Reading assignment MD. 201 (No. 1-3) - by J.Kaulpiboon 6. Check your understanding 2 3000 bp. 1500 bp - 500 bp | |||| لی 3 A J Which lane matches each description below? This lane contains the longest DNA fragment. This lane contains the shortest DNA fragment. This lane contains a 1500 base pair (bp) DNA fragment.. ... A 33% 89% +

Q: A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C]…

A: According to Chargaff's rule the percentage of Adenine [A] is equal to Thymine [T]. So if the given…

Q: Given tubes of equal length and diameter (and the inflow / outfow pressures below), which will have…

A: Blood flow is a pulse wave that moves out from the blood vessels. The flow of blood through the…

Q: 16/ The phosphates that make up the phosphodiester bonds in DNA have pKa  2. What is the sign of…

A: pKa of the phosphodiester bond in DNA = 2 It is desired to calculate the charge on DNA at neutral…

Q: How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect…

A: Before an answer is given, the process of DNA replication must be understood. First there are two…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: 7. You are studying the folding and stability of a bacterial nuclease. Upon exposing the enzyme to 8…

A: Introduction :- Bacterial nuclease is an enzyme that hydrolyzes the phosphodiester bonds of nucleic…

Q: 93. Which is a common function for the protein product of a cancer-causing gene? a) a role in DNA…

A: Cancer-causing genes, like the name implies are genes that lead to the development of cancer. We…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: this gene was amplified from each member of the family and run on the gel shown below. The thickness…

A: Ocular albinism : It is a genetic disorder which is characterized by vision abnormalities in…

Q: 7 a-d. i. ii. Draw the Hydrogen bonds between the base pairs and label the atoms that participate in…

A: There are 2 conventional base pairs in DNA. They are; Between Adenine and Thymine Between Guanine…

Q: BamHI Haelll Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 How long is the original DNA molecule?

A: If it is a closed circular DNA, BamH1  cut it into three fragments of length 10kb 5kb 2kb

Q: I. A mutation that converts glutamic acid to glycine is classified as a missense mutation. II.…

A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: 3 The restriction endonuclease PstI cuts DNA symmetrically on both strands at the СTGCAG sequence:…

A: Restriction endonucleases are the enzymes that are used to form cuts inside the DNA molecule. It is…

Q: DNA ladder 1 DNA ladder 2 bp ng/Sul 10000 8000 40 40 6000 3000 40 4000 40 700 600 3000 40 500 -2000…

A: Agarose gel electrophoresis is used to separate DNA molecules.

Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…

A: Mutations are DNA errors that occur during life. A mutation is defined as any alteration in the DNA…

Q: Adds nucleotides in in the 5' to 3' direction during transcription. [Select ] [ Select ] ligase…

A: RNA polymerase

Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…

A: Agarose gel electrophoresis is a method of gel electrophoresis that is used to separate a mixed…

Q: 3. Primer Design You are analyzing the

A: Primer is a short stretch of oligonucleotide which is designed to copy the gene sequence of interest…

Q: Draw double-stranded DNA (two basepairs long with one AT basepair and one GC basepair). Your drawing…

A: Basic structure of DNA and the structure of different nitrogenous bases.

Q: Not just generic "degradation" or even shorter DNA fragments, what specific structure change in…

A: The hyperchromicity effect is a phenomenon observed in double-stranded DNA that involves changes in…

Q: Agarose gels with different average pore sizes areneeded to separate DNA molecules of different…

A: Gel electrophoresis is a procedure used in molecular biology that is used for separation of…

Q: 92. You have sequenced a short piece of DNA (by chain termination sequencing) and produced the gel…

A: As we know we have to depict the sequence of any amino acid sequence transcribed from 5' end to 3'…

Q: 5) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between…

A: DNA Polymerase and Ligase are the two classes of enzymes that take part in DNA replication and…

Q: E. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…

A: A mutation is a change in our DNA sequence that happens as a result of errors in DNA copying or…

Q: The anticodon sequence created from the following DNA: TACGGGGCTGAGATT Select one: O a.…

A: The sequence of nucleotides that complement codons is known as an anticodon. They are found in tRNAs…

Q: You prepare a reaction mix containing (i) DNA polymerase II, (ii) DATP, dCTP, DGTP, Mg2+, and…

A: DNA replication is considered a process, during which new strands are synthesized.

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: . Pancreatic deoxyribonuclease I (DNase I) is a nuclease that makes single-strand nicks on…

A: The genetic material DNA is packaged in eukaryotic cells with the help of histone proteins. The DNA…

Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show…

A: The malting temperature (Tm) of the DNA  is the temperature at which at least 50% of dsDNA is…

Q: (a) Provide the sequence of the DNA complementary to the following strand (please write it in the 3'…

A: Complementary DNA  Complementary DNA (cDNA) could be a DNA copy of a mRNA (mRNA) molecule created by…

Q: d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to…

A: Deoxyribonucleic acid is also known as DNA and ribonucleic acid also known as RNA are two types of…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature formula :  Tm = 4* (G+C) + 2 * (A+T)  Number of G+C = 6  Number of A+T = 20

Q: . The DNA polymerases are positioned over the following DNA segment (which is part of a much larger…

A: Introduction  DNA replication is very crucial process for the continuation of life as every new…

Q: A geneticist is interested in determining the locations of methylated cytosines within a fragment of…

A: Sodium bisulfite (NaHSO3) is a potent deamination agent. It removes an amino group (-NH2) from…

Q: b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand DNA…

A: The mRNA is produced from the DNA template by the transcription process and then mRNA is used for…

Q: (11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of…

A: