Answered: A) Using this rule, determine the… | bartleby

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Question

Practice Pack

29.)
equalities now called Chargaff's rule.
Biochemist Erwin Chargaff was the first to note that, in DNA, [A]=[T] and [G]=[C],
A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine.
[A] =
[C] =
[G]
[T] = 20%
%3D
-
B) If a single strand of RNA is 20% uracil, what can you predict about the percentages of
the remaining bases and why?

Expert Solution

Learn your way

Includes step-by-step video

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Blurred answer

Similar questions

1) The Nde1 enzyme comes at a concentration of 40 U/ul. According to the manufacturer, the container has enough for 10,000 reactions of 2 ug of DNA, assuming that 1 U/ug of DNA is recommended. How many units in total does the packaging contain? At what concentration in U/ml does the enzyme come? If I had to use 10 U for a reaction of 10 ugs of DNA, how would I serve it? 2) A serially diluted phage solution is used to inoculate an E coli plate in the double-layer plate assay. In 24 hours you count 148 plaques. Considering that the original stock was 0.1, and that you used the sixth dilution of the series, what is the PFU for that phage in this strain of E coli? What is the dilution factor for this plate?
If you analyze a double-stranded DNA molecule and find that 15% of all the nucleotide bases are Adenines, you know that there must also be [ Select ] Thymines, [ Select ] Guanines, [ Select ] v Cytosines and [ Select ] Uracils. (Count each of the bases in any double stranded DNA molecule and calculate their percentages to find the simple key for this if you haven't seen it yet.)
If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG Use the editor to format your answer
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________
DNA structure depends on base pairing of its four nucleotides, A, C, T, and G. Nucleotide A pairs with T, and nucleotide C pairs with G. This forms a four-letter DNA “alphabet." Because DNA codes for amino acids in sets of three nucleotides, there are 4 cubed (4'), or 64, possible combinations, coding for 20 different amino acids. What is the best explanation for why there is no selective advantage for DNA to have five nucleotides (e.g., A, C, T, G, and E) with C pairing with either G or functionally equivalent E? It would be impossible to form the DNA molecule, because it must have an equal number of Cs and Gs. Because G and E have the same role, there would still be four functional letters of the alphabet. Replication would be inaccurate because sometimes C would bond with G and sometimes C would bond with E. There would be a five-letter alphabet with 125 combinations, which is too numerous. It is impossible because there are not five known nucleotides in the cell.
a) It is known that double stranded DNA is denatured at low pH. pKa values should allow the determination of whether this is due to perturbation of the hydrogen bonding in A-T and/or G-C base pairs. The table gives values for the pKas of different protonated groups in the nucleobases.Nucleobase Position & pKa A N1, 3.5 G N7, 1.6; N1, 9.2 C N3, 4.2 T N3, 9.7a) Draw the A-T and G-C base pairs. - Label the bases with the one-letter code. – - Number the atoms in the rings and label the atom that attaches to the sugar. - Mark the groups that interact in normal…
Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?
If a DNA double helix contains 28% T nucleotides, then what is the percentage of A nucleotides?
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?
The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.
Assume that the molar percentage of thymine in a double stranded DNA is 20. What are the percentages of the four bases (G, C, T, A)? b. The base content of a sample of DNA is as follows: A=31% G=31% T=19% C=19%. What conclusion can be drawn from this information?
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' Draw the structure of hairpin loop that will be formed during the end of transcription.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS