E. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a I, he has a G. 5' AATCATAACTCATTG 3' What type of mutation does he have? Second position First position (5'-end) с A 0000. U UUU UUC phe UUA UUG CUU leu CUC CUA CUG AUU AUC ile AUA AUA AUG met ACG GUU GUC GUA GUG UCU UCC ser UCA UCG val CCU ccc CCA CCG ACU ACC ACA thr ACA pro GCU GCC GCA ala GCG Missense Silent UAU UAC tyr Nonsense UAA Stop UAG Stop CAU CAC his CAC CAA gin CAG AAU AAC AAA AAG asn lys GAU GAC asp GAA glu GAG Initiation Termination Frameshift UGU cys UGC UGA Stop UGG trp CGU CGC CGA CGG arg AGU AGC AGA AGG GGU GGC GGA 9 GGG ser arg gly DOMO DOMO DURO DUAO Third position (3-end)

Q: 5' AU Py U A AGGCC G. UGGC G C G GGG What modified nucleoside base is indicated by the arrow?…

A: The answer of the above question is : Pseudouracil (Ψ). Pseudouridine (psi- Ψ)is an isomer of the…

Q: r The sequence change shown below is the result of what kind of mutation? Coding DNA sequence before…

A: Mutation: Mutation refers to a process that results in a permanent change in the DNA sequence of an…

Q: G. Aureliano has a mutation in the blue-shaded nucleotide in the TEMPLATE DNA sequence. Instead of a…

A: A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of DNA copying…

Q: functions. The structure that provides high processivity (processivity factor) is represented by the…

A: Letter A denotes core polymerase enzyme B denotes tau protein C denotes gamma clamp loader D denotes…

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: A frameshift mutation could result from either an insertion or a deletion of a base deletion of…

A: Mutation refers to the process of sudden change or alterations in the sequence of nucleotides of an…

Q: 5' guanine cap 5' AUGCCGAUGCCUCCUAUCAGAUAAAAUAAA poly A tail AAAA 3' During DNA replication, a…

A: The mutation is the sudden and abrupt change in the structure and function of the chromosomes.

Q: SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide…

A: Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…

Q: H. State if/how Aureliano's mutation changes the amino acid sequence and describe the effect that…

A: Mutations are changes in the DNA sequences. It may be due to many reasons. There are many type of…

Q: C RNA 5' UGGU I III II ACCAT CAGTC A G II TEMPLATE DNA 5' RNA polymerase

A: Transcription: Formation of mRNA from DNA with the help of enzyme RNA polymerase.

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: EcoRI Sacl Kpnl Aval ampR Xmal Smal lacZ BamHI Xbal Sall Accl HinclI Pstl Sphl HindIII Bam H1 Bam H1…

A: Answer :- Option (C) is correct. - 1. :-

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: a. Which amino acid does this code for? [Select] dentify the effect of the following point mutations…

A: Introduction Mutation is a sudden heritable change in our DNA or genetic material. Mutation can…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: I need help because i don't get it. Can you help me to explain to me, please?

A: DNA It refers to the molecule that constitutes genetic information that is passed from generation ot…

Q: There are various types of DNA-targeting drug, including DNA alkylating agents, DNA intercalators…

A: Mutations are DNA errors that occur during life. A mutation is defined as any alteration in the DNA…

Q: Explain Corrected Statement Briefly explain: Why the original statement was incorrect How your…

A: Mutation : It is a sudden heritable change , individual that showing these changes are termed as…

Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…

A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…

Q: How will this mutation affect the golden retriever puppy?

A: Transcription is the process which makes mRNA from DNA in complementary manner. The A, U, G and C of…

Q: A certain section of the coding (sense) strand of some DNA looks like this: SATGTATATCTCCAGTTAG-3…

A: Alternation of DNA sequence or any other charge in the chromosome shape or number is considered as a…

Q: What was the purpose of the random hexamer primers? O primer for GoTaq O amplify the MRNA O primer…

A: Primer These are the short nucleic acid sequences that are are helpful in providing an initiator…

Q: Which of the following represents a base analog acting as a mutagen? O ethidium bromide O guanine O…

A: In hereditary qualities, a mutagen is a physical or compound specialist that changes the hereditary…

Q: A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: The original wild-type" DNA strand is: 5'-ATGGGACTAGATACC-3'. Which allele is least likely to show a…

A: A DNA mutation is a permanent change in the DNA sequence that can be passed on to subsequent…

Q: Figure 1 shows a DNA base sequence. It also shows the effect of two mutations on this base sequence.…

A: Given DNA bases:  A T T G G C G T G T C T   The amino acids of the DNA triplets are also given.

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Gene is a part of the DNA, located on a specific site on the chromosome and has a specific sequence…

Q: Look at the image of the the dinucleotide (two nucleotides joined togethr in a single strand). Base…

A: Nucleotide are the basic building blocks of DNA. A nucleotide consists of a sugar, nitrogenous base…

Q: 47 If base #6 is changed from A to T, what type of mutation is this?? ANTISENSE STRAND 5' ATTTGACGG…

A: Antisense strand is also known as template strand. This strand is used to produce mRNA during…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.