C RNA 5' UGGU I III II ACCAT CAGTC A G II TEMPLATE DNA 5' RNA polymerase

Q: What is the corresponding RNA sequence, if the DNA sequence reads TACACCTGG?

A: The RNA or ribonucleic acid is single stranded macromolecule that is composed of nucleotides. RNA is…

Q: et’s return to your patient with sickle cell anemia.  Below is the RNA sequence from your patient…

A: Sickle cell disease causes often term that they are  usually state as chronic hemolytic anaemia,…

Q: Which macromolecule is related to a. Genotype ? b. Phenotype ?

A: Phenotype and genotype are the two ways by which we express traits.

Q: Below is a primary sequence alignment between the wild-type hemoglobin protein, and the hemoglobin…

A: Hemoglobin can be described as a pigmented protein that forms a component of the red blood cells or…

Q: How are ribosomes affected in treacher Collins Syndrome disorder? Please write it in a…

A: Treacher Collins syndrome (TCS) is a genetic disorder which is characterized by deformities of the…

Q: Let’s return to your patient with sickle cell anemia.  Below is the RNA sequence from your patient…

A: Sickle cell anemia is a recessive disorder.

Q: Mutations conferring resistance to bactericidal agentssuch as __________ or bacteriophages

A: Bacteria are organisms that have a single cell and are considered the most primitive organisms on…

Q: CT/TGT/AAG/ACC/TTT What would be the amino acid sequence created from this mutated DNA strand?

A: The central dogma theory in genetics is based on the processes of Replication, Transcription and…

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

A:

Q: A typical STR DNA type emanating from a single individual shows a (one, two, three)-band pattern.

A: STR stands for Short tandem repeats, which are useful for forensic scientists because they enable…

Q: Identify the structure indicated by the Yellow arrow.

A: The human body is a well built machine in which all the organs coordinate together to make it work.…

Q: Complete the following table and answer the next two questions.   DNA____________ strand         T…

A: The process of synthesis of RNA with the help of complementary strand of DNA is called…

Q: Create the complementary DNA strand: ACC-GCC-TAG-GCA Your answer

A: Complementary DNA (cDNA) is a copy of DNA from the mRNA molecule produced through a reverse…

Q: Why was it necessary to soak the gel in hydroxide before performing the blot?

A: Gel electrophoresis is a technique which is used to separate the molecules based on the size of the…

Q: Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: The process of transcription is represented by letter

A: DNA is transcribed into mRNA and mRNA is translated into protein.

Q: Once you have cut your circular DNA it becomes linear and you need to insert/glue the functional…

A: Recombinant DNA technology It is a technique that alters the phenotype of an entity(host) when a…

Q: You create a premature stop codon as a result of an induced mutation in the lab. What type of…

A: Premature termination codons (PTCs) are the result of one-nucleotide changes that transform a…

Q: If mRNA is UUACGC what is the DNA? Read from right to left. O TGCATT O UGCATU O TTUCGC UCGUTT AATGCG

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Let’s return to your patient with sickle cell anemia.  Below is the RNA sequence from your patient…

A: A)

Q: Briefly explain why all viruses with a RNA genome (excluding retroviruses) must produce their own…

A: RNA polymerase is a protein that converts DNA sequences into RNA and then synthesizes new strands of…

Q: Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from…

A: Codon is the triplet of either DNA or RNA nucleotides which codes for a specific amino acid during…

Q: Circle the correct word or phrase in each bracketed region to complete a correct statement.…

A: CRISPR gene editing CRISPR is Clustered Regularly Interspaced Short Palindromic Repeat. It is a…

Q: Read the images given before answering the question below. Identify the two common diseases that…

A: When any change occurs in the order of DNA sequence naturally or synthetically it is called…

Q: Please write a paragraph that compares and contrasts transformation, transduction, and conjugation…

A: Transformation, conjugation and transduction are the specialised process in bacteria or prokaryotes…

Q: For the following sequence please design an 18 base pair forward primer.  ATG TCA AAA GCT GTC GGT…

A: Introduction :  Primers are short oligonucleotides that are chemically synthesised and complementary…

Q: Look at the amino acid chart below that the proctor placed on a board at the front of the classroom…

A: Sickle cell anemia is an inherited blood disorder that affects the structure and function of red…

Q: Draw a generalized nucleotide. Just put “base” instead of drawing the actual base. Label the carbons…

A: Nucleotides are the monomer units of biological polymers nucleic acids (DNA and RNA). They composed…

Q: I need help defining what is DNA Chromatography.

A: Chromatography is known as the most efficient methods that is utilized in purifying as well as…

Q: (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: DNA…

A: Genetic material is the hereditary substance in the cell. It carries all information specific to…

Q: For the following sequence please design an 18 base pair REVERSE primer.  ATG TCA AAA GCT GTC GGT…

A: Primers are short single-stranded nucleic acid sequences that bind onto template strands and added…