What is the resulting polypeptide: _______________________________________________________?What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide.Is this more or less harmful than the previous mutation in step #10? Why? **DNA Sequence Transcription and Translation Simulation**In this interactive DNA-to-protein simulation, we explore how DNA sequences are transcribed and translated into proteins. **DNA Sequence Entry:**- **Original Sequence:** `ATGCCAGGCGCGAGCTCGCTAATTGCGTTATAG`- **Edited Sequence:** A text box allows users to input and modify the DNA sequence.**Features and Tools:**- **Edit DNA:** Allows manual input or editing of the DNA sequence to observe changes in protein synthesis.- **Transcribe and Translate Options:** Users can transcribe DNA into mRNA and translate it to see the resulting protein sequence.**Visual Components:**- **Nucleotide Symbols:** Represented as colored shapes (rectangles, hexagons, etc.) along a horizontal line, depicting the DNA and mRNA strands.- **Amino Acids:** Symbols above the nucleotide sequences show the amino acids being synthesized. Current sequence: - Serine (Ser) - Glutamic Acid (Glu) - Proline (Pro) - Glycine (Gly) - Methionine (Met)**Interactive Buttons:**- **Show DNA, Transcribe, Translate, Show Protein:** Allows stepping through each stage to visualize DNA conversion into proteins.- **Control Functions:** Include “Continue one step,” “Start/continue model,” “Stop,” and “Reset” for managing the simulation process.This educational tool is useful for visualizing the central dogma of molecular biology, illustrating how genetic information is converted into functional proteins.

Answered: What is the resulting polypeptide:…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Concept explainers

Question

What is the resulting polypeptide: _______________________________________________________?
What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide.
Is this more or less harmful than the previous mutation in step #10? Why?

**DNA Sequence Transcription and Translation Simulation**

In this interactive DNA-to-protein simulation, we explore how DNA sequences are transcribed and translated into proteins.

**DNA Sequence Entry:**
- **Original Sequence:** `ATGCCAGGCGCGAGCTCGCTAATTGCGTTATAG`
- **Edited Sequence:** A text box allows users to input and modify the DNA sequence.

**Features and Tools:**
- **Edit DNA:** Allows manual input or editing of the DNA sequence to observe changes in protein synthesis.
- **Transcribe and Translate Options:** Users can transcribe DNA into mRNA and translate it to see the resulting protein sequence.

**Visual Components:**
- **Nucleotide Symbols:** Represented as colored shapes (rectangles, hexagons, etc.) along a horizontal line, depicting the DNA and mRNA strands.
- **Amino Acids:** Symbols above the nucleotide sequences show the amino acids being synthesized. Current sequence:
- Serine (Ser)
- Glutamic Acid (Glu)
- Proline (Pro)
- Glycine (Gly)
- Methionine (Met)

**Interactive Buttons:**
- **Show DNA, Transcribe, Translate, Show Protein:** Allows stepping through each stage to visualize DNA conversion into proteins.
- **Control Functions:** Include “Continue one step,” “Start/continue model,” “Stop,” and “Reset” for managing the simulation process.

This educational tool is useful for visualizing the central dogma of molecular biology, illustrating how genetic information is converted into functional proteins.

Expert Solution

Step 1

Central dogma is the central processing part in which DNA is converted into m RNA by transcription and mRNA into protein by translation

Any muttation in between can cause problems in identifying the codons and the structure of the protein will be distorted.

Step by step

Solved in 3 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions