Question: Hi, can someone help me with this question thanks in advance.  Select one of the following genetic diseases that appear in the following list: galactosemia cystic fibrosis Down's Syndrome familial hypercholesterolemia muscle gystrophy Huntington's disease sickle cell anemia hemophilia Tay-Sachs disease describe a composition about how the selected condition is generated.  Include details about the number of people who report the disease, symptoms, treatments, among other aspects that you consider important. thanks

Q: Cystic hibros Ife-threatering disease that causes thick, stcky mucus to buid up in areas of the…

A: DNA is the genetic material in living organisms that is transcribed into mRNA. This mRNA is used for…

Q: 1. In your own words define the process of DNA Replication, Transcription, and Translation.

A: DNA Replication  In the process of DNA replication, the DNA makes multiple copies of itself. It is a…

Q: 1. Below is a partial sequence of a guide RNA. The underlined section of the RNA is designed to…

A:

Q: Complete the tables below to determine the polypeptide chain of a functional and mutated hemoglobin…

A: 1st Six Codons of the Functional Hemoglobin Gene... DNA.. GTG CAC CTG ACT CCT GAG  mRNA codon is ..…

Q: 6. How, specifically, can the BCR-ABL protein be inhibited, and what causes this inhibition to…

A: Anticancer medications inhibit cell reproduction and may not prevent cancer cells from spreading.…

Q: Enzymes are specific. They are match up with a specific and particular reactant. During the…

A: Enzymes are protein molecules which consists of an active aite where substrate binds to catalyze the…

Q: Question 10 Listen Donna is heterozygous for both hemophilia (a sex linked recessive trait) and…

A: The objective of this question is to determine the probability of Donna and Michael's sons…

Q: Please use the following terms and describe how each works to control protein expression. -…

A: The process in which the DNA is trans formed into an mRNA is known as the process of transcription.…

Q: Please answer fast Place the steps for performing SNP-chip analysis in the correct order.…

A: SNP refers to single nucleotide polymorphism, in this the frequency greater than 1% in single…

Q: thymine nucleotides

A: Nucleic acids:These are long linear polymers that carry information that can be passed from one…

Q: 9. How many total chromosomes are in a somatic cell of this organism that is in Metaphase of…

A: Introduction:-  Cell cycle is composed of interphase in which cell DNA replication occurs and cell…

Q: Please answer this quickly

A: The cells are of two types - prokaryotes and eukaryotes. Prokaryotes are primitive cells without any…

Q: A. Given the following piece of messenger RNA (mRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAG…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Some scientists have concluded that this method of gene therapy will be a more effective long-term…

A: Hematopoietic stem cell transplantation (HSCT) involves the intravenous (IV) infusion of autologous…

Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: t to scale and spindles are not drawn in, however the relative positions of romosomes are…

A: Mitosis and meiosis are two types of cell divisions. Mitosis usually occurs in all the normal cells…

Q: 2. Justin: A CGT I I C. What is the sequence for this portion of Justin's p53 gene?

A: The Sanger sequencing use chain termination process because it use ddNTPs. When ddNTPs are…

Q: Question 10. This graph shows data on incidence of stomach cancer in Japanese people living in Japan…

A: Cancer is a disease condition in which the body's cells grow in an uncontrollable way or in a way…

Q: You have cloned the gene for a human erythrocyte protein, which you suspect is a membrane protein.…

A: A hydropathy plot is a tool used to visualize the hydrophobicity or hydrophilicity of a protein…

Q: 2', 3'-Dideoxyinosine has been approved as an anti-HIV drug. Propose a mechanism by which it might…

A: The management of HIV/AIDS normally includes the use of multiple antiretroviral drugs in an attempt…

Q: For genotype: repP lach lacPt lacO+ lacZt lacY Select the best description of beta-galactosidase…

A: Beta galactosidase is an enzyme which breaks the disaccharide lactose to produce galactos and…

Q: Please help me with this question. More than one answer may be correct. THe graph relating to the…

A: The graphical representation illustrates the percentage of cells exhibiting clusters of IRE1…

Q: Question 5. Which enzyme is used in the processing of miRNAs that are encoded in the genome but NOT…

A: Introduction - The silencing complex is made up of short interfering RNA (siRNA), miRNA, and the…

Q: QUESTION 5 f a family with 15 members, 9 members had the A specific example of incomplete penetrance…

A: Given  Out of 15 families only 9 have mutation And out of 9 families only 6 shows the disease.

Q: What is the first step in protein synthesis? A. making an RNA copy of the DNA within the nucleus

A: In eukaryotes, they are made of DNA and a membrane-bound nucleus. The eukaryotes make their own…

Q: 9. Using your knowledge of DNA repair pathways, choose the pathway that would be used to repair the…

A: DNA repair pathways are a set of processes by which cell defines and corrects the damage to DNA that…

Q: B. Transcript and Translate the following: DNA-TACTGATCGACCCCCATAATGAAAATCGGGCCC mRNA- AA- DNA-…

A: Here we are assuming the DNA strand to be the template strand and not the coding strand, becuase…

Q: Work in a small group or alone to complete this exercise. In Lab 2, Exercise 8, you determined the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: 3. Listed within this chart are descriptions of a variety of DNA mutations. Your job is to fill in…

A: *Mutations cause change in  DNA sequence thar are resulted from DNA copying errors during cell…

Q: The DNA translocation generating the Philadelphia chromosome involves which protooncogene and is…

A: Philadelphia chromosome results from reciprocal translocation . Therefore, it is defective and…

Q: Molecular Tool box for Genetic Manipulation of (organism) Source Organism Characteristics/Ability…

A: Genetically modified organisms or GMOs are the animals, plants or microbes which have been…

Q: 11. Why does Vincent tell Irene. "You are the authority of what is not possible"? How does Vincent…

A: The concept of Gattaca is simple and brilliant: in the near future, genetic engineering enables…

Q: QUESTION 6 If you performed the experiment outlined in question 6 with full-leng would you observe…

A: This graph is represented (question 5) between the relative fluorescence units (y-axis) and Time…

Q: Describe an assay that could measure the activity of adenylyl cyclase (AC).

A: Introduction: Adenylyl cyclase (AC) is an enzyme that catalyzes the conversion of ATP to cAMP in our…

Q: A 53-year-old man is referred to a neurologist because he is beginning to develop spastic- like…

A: Huntington's chorea is a neurodegenerative disorder characterized by abnormal involuntary movements…

Q: Your lab is investigating cellulose degradation by Cellvibrio japonicus and has generated a large…

A: Genes encode for proteins that help in the growth of any organism. To check the importance or…

Q: "Gain of function" mutations are generally dominant because one copy in a diploid organism is…

A: Gain of Function: It is a type of mutation in which the altered gene product has a new molecular…

Q: Huntington's Disease is an autosomal dominant disorder caused by trinucleotide repeat expansion.…

A: Huntington's disease is an autosomal dominant disease. It is caused by trinucleotide (CAG) repeat…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The gene is expressed from DNA into protein by Central Dogma. The transcription and translation…

Q: A single mutation occurs in the coding region of a gene and results in a non-functional gene product…

A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…

Q: Cell lysis and protein purification of GST-DHFR-His using T7 RNA polymerase protein to express DHFR…

A: A flowchart is a diagram that shows the steps of the process through a workflow which makes it…