Would love a list of different types of nucleotide repeat disorders.

Q: Please help me with this. *Also Please Note: This is ONE problem set and according to the policy,…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: How can you treatment for the genetic disorders by using gene therapy?  Please answer at your own…

A: Gene therapy is a technique for correcting imperfect genes responsible for disease development. Gene…

Q: Briefly, be able to define each of these AND, where relevant, tell what do they do, and which…

A: As per our guideline we are allowed to answer only starting three.  Please repost the other.

Q: I don't get it. I need help to explain to me

A: Mutation can be classified as small -scale or large- scale. In the concerned mutational phenomenon,…

Q: Discuss about DNA damage response system

A: Due to some internal or external factors, the DNA of the cell may undergo certain alternation in its…

Q: Please explain it simply, and don't over-explain. Thanks!

A: DNA is a genetic material that regulate all functions and character of our body. It condensed to…

Q: Alpha polypeptide (ADH1A). Give a detailed description of its role in the disease. Describe the…

A: Alpha polypeptide (ADH1A)- Alcohol dehydrogenase 1A is a type of enzyme which in humans it is…

Q: Which of the following is the deadliest genotype for the Tay Sachs allele? O t O Tt O TT

A: Tay-Sachs disease or TSD is a lysosomal storage disorder. The cause of this disorder is a mutation…

Q: Which of the following statements about the DNA is FALSE? O DNA occurs in the form of double…

A: Deoxyribonucleic acid (DNA) is the genetic material of the cell. It has the information for…

Q: Lay out the genetics of Nicholas’s case, including where the mutationoccurred, what exact nucleotide…

A: Nicholas was a 2 year-old boy with an extreme case of inflammatory bowel disease and susceptibility…

Q: 2. Another kind of mutation is the so-called frameshift mutation, caused by an insertion or a…

A: Frame shift mutation occurring due to insertion or deletion of single nucleotide will lead to shift…

Q: Modern maize is derived from teosinte, a weedy plant that grows in South and Central America. A key…

A: The question relates to the hereditary evolution of maize from its precursor, teosinte. The tb1 gene…

Q: Explain Shortly. I need help   The emergence of new molecular biology techniques has allowed…

A: You have asked three parts of a question. Third part is a personal opinion on this topic, so I won't…

Q: a. What specific type of VECTOR will you use to perform your gene therapy? Please select from the…

A: Gene therapy is a treatment in which the genes that are missing or not normal in your cells are…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: The DNA is composed of purines and pyrimidines. The purines in DNA are adenine and guanine. The…

Q: Choose the primary impact of the given agents to the genetic material. 1. Metronidazole 2.…

A: Gene inhibition is a therapeutic approach that leads to the silencing of the expression of a mutated…

Q: Within the general field of biotechnology, DNA technology uses modern laboratory techniques for the…

A: DNA technology refers to modern laboratory techniques used for studying, analyzing, and manipulating…

Q: Mechanization of transportation has allowed mass movement of humans all around the globe in the past…

A: Globalization is a complex and multi-faceted set of processes that has a wide range of effects on…

Q: is it possible that pcr primers could bind and amplify a sequence of dna that is difference from the…

A: Polymerase Chain Reaction (PCR) is a technique that gives us multiple copies of desired DNA…

Q: Not make to copy or incorrectly do. Else downvote.

A: We know that Genotype is defined as the genetic makeup of an individual organism and it is the sum…

Q: Question 2. You want your recombinant Human Growth Hormone to be tagged at the N-terminus with a…

A: Cloning is a process of making copies of the a segment such that they are exactly similar to the…

Q: Mutations can be classified as small-scale or large-scale, depending on the number of nucleotides…

A: a) change from CCGATG to CCGGATGThe sequence is altered from CCGATG to CCGGATG by the insertion of…

Q: In an ongoing research of the Philippine Genome Centre, using a repeating copolymers, ACA....…

A: A copolymer is a polymer made up of two or more species of monomer. Periodic copolymers are made up…

Q: Please Answer ASAP. Thank u. Genetically modified plants resistant to the herbicide glyphosphate…

A: Genetic modification is a technique in which a desired stretch of DNA (gene of interest) is inserted…

Q: How were chaperones discovered?

A: Molecular chaperons are proteins that assist the conformational folding or unfolding and the…

Q: What role did Chargaff play in discovering DNA as the genetic material and molecular structure? O…

A: Erwin chargaff played a huge role that  contributed to the discovery of double helix structure of…

Q: what is the 6 main basic procedure of genetic engineering?

A: Genetic engineering is a branch of science in biology which deals with study of the genetic material…

Q: Under normal conditions, an mRNA molecule that is 99 bases long will create a protein composed of: -…

A: Note: According to bartleby guidelines only first three subparts are to be answered. So please…

Q: Explain Corrected Statement Briefly explain: Why the original statement was incorrect How your…

A: Mutation : It is a sudden heritable change , individual that showing these changes are termed as…

Q: Why do you think DNA supercoiling is important to the ?bacterial cells

A: DNA replication is a process by which DNA is copied or replicate and pass on to its daughter cells.…

Q: 14.11) Fill in the missing one-letter abbreviations for the organic bases in the image below to show…

A: Maurice wikins and rosalind franklin proposed a very simple but famous double helix model for the…

Q: Our DNA sequence: 5' - CGCTTATAATCGTTACGACGGCAATTA CGGGATTCCTCGCGAAA - 3'. What is the RNA…

A: The nucleic acids are DNA and RNA. Nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: POST-ACTIVITY SKIL 1. The E2F family of transcription factors is important in regulating the cell…

A: Transcription factors are protein molecules which bind to specific DNA sequences to regulate gene…

Q: Name 2 differences in the structural features of DNA and RNA and indicate the relevance of each…

A: RNA and DNA are the two types of nucleic acids present in the living system. Nucleic acids are…

Q: Sickle cell anemia is the result of a type of mutation in the gene that codes for part of the…

A: Sickle-cell anemia is a genetic disease characterized by the sickle shape of the RBCs. It results in…

Q: Enumerate the steps involved in gene cloning and the protein/enzyme requirements for each step. Just…

A: The technique of creating numerous, exact copies of a specific portion of DNA is known as DNA/gene…

Q: What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for…

A: CRISPR technology is a powerful tool used for precise genome editing. CRISPR stands for Clustered…

Q: Muller's ratchet can be reversed by mutation. Group of answer choices True False

A: The irreversible accumulation of harmful mutations in asexual populations is known as Muller's…

Q: 9. Using your knowledge of DNA repair pathways, choose the pathway that would be used to repair the…

A: DNA repair pathways are a set of processes by which cell defines and corrects the damage to DNA that…

Q: novel object recognition test

A: Answer: novel object means that presentation of the familiar object exists in animals' memory. The…