What is the resulting polypeptide: _______________________________________________________? What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide. Would this mutation allow the protein for perform the intended function? Why or why not?
Essential nutrients
These are the organic compounds present in the food that provide nourishment essential for the development and growth of our body. Nutrients not only provide us with the required energy to carry out various biological processes but are also the building blocks for repair and growth in our bodies.
Vitamins
The vitamins are organic molecules required in low concentration for the proper functioning of the body. They cannot be generated in the organism and are taken into the body through the diet. The lack of proper vitamins results in diverse deficiency disorders. They are thus called essential nutrients. The important vitamins are vitamin A, vitamin B complex, vitamin C, vitamin D, vitamin K, and vitamin E.
- What is the resulting polypeptide: _______________________________________________________?
- What effect does this mutation have on the polypeptide? Make sure to compare to the original polypeptide.
- Would this mutation allow the protein for perform the intended function? Why or why not?


Mutation in a gene sequence causes encoding of a mutated protein. This mutated protein will have different folding patterns and will not function as the original protein.
Step by step
Solved in 2 steps









