et’s return to your patient with sickle cell anemia.  Below is the RNA sequence from your patient and from her mother.  (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA:  5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ C)  Write out the sequence of the normal beta-globin protein (as much as you can given the above info and below genetic code table) and indicate what would be different in the mutant protein.  Don't forget your ends!

Q: 2. When you move the slide to the left with the stage controls, how does it appear to move through…

A: Introduction  A compound microscope is one that focuses a biological specimen using several sets of…

Q: Match the term in column 2 (A-G) with its definition in column 1. DOD Cloning vector Genome editing…

A: In the molecular biology, various techniques empower scientists to unravel the mysteries encoded…

Q: Below is a primary sequence alignment between the wild-type hemoglobin protein, and the hemoglobin…

A: Hemoglobin can be described as a pigmented protein that forms a component of the red blood cells or…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: What is meant by the term cDNA, and how may a cDNA differ from the gene from which it is derived?…

A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other animals.…

Q: HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5'…

A: Restriction enzyme varies from one other in their restriction sites as well as the type of ends they…

Q: Which forward are reverse primers will amplify the following sequence by PCR?…

A: As given in the question, forward and reverse primer sequences are to be identified to amplify the…

Q: What does BCR ABL stand for?

A: B-cell receptor (BCR) serve in recognition of the antigens and are present at the surface of the B…

Q: A) Describe each step of the DNA REPLICATION in EUKARYOTIC organisms B) Describe each step of the…

A: Transcription = Re-writing DNA into RNADNA is "transcribed" or re-written into RNA in a very…

Q: Name TWO functions of the 5'UTR.

A: Solution The 5' UTR plays important role in stability, processing and localisation of mRNA.  5' UTR…

Q: 6. Identify the DNA sequence below. Write the DNA sequence in 5' to 3' orientation.

A: The DNA (deoxyribonucleic acid) sequence is the order in which the nucleotide bases are arranged.…

Q: Identify what type of mortality indicator is depicted in the following graph. a. Age-specific…

A: Introduction Mortality  is calculated death per 100,000 person, fatality is calculated death per 100…

Q: Next-Generation Sequencing (NGS): NGS is a newer testing technique that is used to identify the…

A: Next-Generation Sequencing (NGS) is a process used to rapidly sequence the nucleic acid in an…

Q: Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase…

A: Each time a cell divides, the telomeres get shorter. Telomeres are a region of repetitive nucleotide…

Q: Sickle-Cell Anemia is one disease that arises from a known point mutation in a protein.  This…

A: Sickle cell anemia is a genetic disease. This disease is especially common for Africans.

Q: I read that vinyl chloride exposure is associated with an increased risk of a rare form of liver…

A: Cancer is the condition of uncontrolled cell division.

Q: ckle cell anemia is a hereditary disease in which a faulty hemoglobin (Hb S) molecule is produced. A…

A: Hemoglobin is an iron-containing protein present in the red blood cells (RBCs). It transports oxygen…

Q: The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine…

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: Type of Point Frameshift mutation Substitution Insertion or Deletion 10 (Circle one.) How did the…

A: Nucleus is chief controller of cell in which genetic information is safely stored . It exhibit long…

Q: A DNA nucleotide is composed of what three parts and are held together by

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Cells contain both DNA and RNA. What difference between the structures of these nucleic acids (that…

A: The DNA and RNA are nucleic acids found in the cells. DNA is present in the nucleus while RNA can be…

Q: please identify structure information about this gene which is adgrg1/gpr56. You can identify…

A: Introduction :- Adgrg1 /Gpr56 (Adhesion G-protein coupled receptor G1 ) as its name indicates that…

Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…

A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…

Q: The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine…

A: Codon is a sequence of three nucleotides that together form unit of genetic code in a DNA or RNA…

Q: Use the genetic decoder provided to assist in answering this question.\ Second letter A UUU UUC Phe…

A: Introduction: The process of polymerization of amino acid to form a polypeptide is called…

Q: Look at the amino acid chart below that the proctor placed on a board at the front of the classroom…

A: Sickle cell anemia is an inherited blood disorder that affects the structure and function of red…

Q: 4. ANSWER BELOW QUESTIONS: A. First write the original DNA strand. Indicate where the substitution…

A: As per our company policy, the three parts are solved in case of interlinked question. If you want…

Q: Complete the sentences. Each term may be used more than once. In a circular bacterial chromosome,…

A: The structure and behavior of DNA play a crucial role in the functioning of living organisms. In…

Q: Write down the name of the infectious agent of COVID-19 disease.

A: Microorganisms or microbes generally are visible under the microscope only. These include living…

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: ALL GROUPS HAVE A MUTATION MAKE SURE TO IDENTIFY THEM**

A: A mutation is a change in a DNA sequence. It can result from DNA copying errors made during cell…

Q: Discuss with reference to the biological role of glucose and oxygen, the process of aerobic cellular…

A: Aerobic cellular respiration is a metabolic process that occurs in eukaryotic cells, which involves…

Q: What is the resulting polypeptide: _______________________________________________________? What…

A: Central dogma is the central processing part in which DNA is converted into m RNA by transcription…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.