If this is the original sequençe of a DNA strand: CCAGGTCCATGACTTAGC, how would you labeled the one below CCAGGTCCATGACTTTTTTAGC Deletion Insertion (addition) Frameshift In frame insertion

Q: Below is a sample of a segment of DNA…(copy from left to right)   3’…

A: Mutation  It occurs when a DNA gene is changed in such a way as to alter the genetic message carried…

Q: For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show…

A: Polymerase (PCR) chain reaction is a process in which small DNA fragments are amplified into a…

Q: This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation…

A: A mutation refers to any alteration in the sequence of DNA (deoxyribonucleic acid) due to some…

Q: The template strand (notice the directionality) of DNA that is known to encode the N-terminal region…

A: The biochemical material that is transferred from the preceding generation to the succeeding…

Q: A DNA strand has the following sequence:      5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: A DNA strand has the following sequence:   5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’   In which…

A: The deoxyribonucleic acid (DNA) replication involves the multiplication of DNA strands. The DNA is a…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide…

A: Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…

Q: Label the 5'  and 3' end of each nucleotide and approximate where the start point (+1) would be on…

A: The process shown here is called transcription.  In this process a molecule of mRNA is synthesized…

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: The following DNA fragment was isolated from the beginning of a gene. Determine which strand is…

A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions necessary for the…

Q: For the following sequence, transcribe and translate the sequence into a protein. Be sure to…

A: Given strand is DNA template strand- 3'-TACCACCCCCTGAGTGCTGGGATC-5' Transcription of template Strand…

Q: EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments…

A: A restriction site or recognition site, is a specific sequence of nucleotides in DNA that a…

Q: the one above: Replicate this sense strand to create a double-stranded DNA helix…

A: DNA is a double helical structure containing complementary base pairs.  Complementary base pairs…

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: For the template DNA below, which includes one labeled end of the template DNA, clearly label the…

A: DNA replication is a fundamental process in which a cell's genetic material is duplicated, ensuring…

Q: What is the DNA template of the following DNA coding:  ATGGCTAACCTTGTA

A: The DNA template strand is a complementary strand to the DNA coding (sense) strand. It serves as a…

Q: In the following gel showing stained bands of the Alu insertion sequence, what is the gem of…

A: In the gel, the presence of a band at 941 bp indicates the presence of the Alu insertion sequence,…

Q: Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this…

A: A codon is a three-nucleotide sequence of DNA or RNA that corresponds to a specific amino acid or…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide…

A: Transcription is the process of converting a portion of DNA into RNA. RNA polymerase is the enzyme…

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…

A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…

Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…

A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…

Q: explain why the order is 3–1-4-2 and not another way, thank you so much

A: Shotgun sequencing It is a method used in laboratories to identify the DNA sequence of a genome. The…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…

A: The hydrolysis is targetting the 3' Carbon of the sugar in the phosphodiester bond. 1st strand…

Q: DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl…

A: DNA polymerase is a main enzyme for DNA replication.. The two main requirements for working of  DNA…

Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5': Use all…

A: Note that in determining the complementary of a DNA sequence, always remember that adenine (A) pairs…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.