the one above: Replicate this sense strand to create a double-stranded DNA helix  TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT   2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3.  How many amino acids were changed in the mutated polypeptide?

Q: For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show…

A: Polymerase (PCR) chain reaction is a process in which small DNA fragments are amplified into a…

Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…

A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…

Q: The following DNAs were incubated with E. coli DNA Polymerase I and dNTPs. Write the products…

A: DNA replication is the process by which new DNA is synthesized from the old DNA by semiconservative…

Q: A 210-bp sequence within the CFTR gene on human chromosome 7 is shown below. The three bold…

A: A primer is a short DNA sequence that serves as a starting point for DNA synthesis in a polymerase…

Q: Design PCR primers for the DNA sequence given below and explain your choice. As part of your answer,…

A: It is a Polymerase Chain Reaction, which is a mechanism for multiplying a specific piece of DNA…

Q: In a Sanger DNA sequencing reaction (dideoxy method) you use the primer 5′-GCATATA-3′ to sequence a…

A: Sequencing of DNA refers to the biochemical methods for determining the order of the nucleotide…

Q: 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: 2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked…

A: The answer is option A  In the PCR amplification, two primers are used to flank the target region to…

Q: With regards to this sequence below please answer this quistions 1) What is the format of the…

A: answer given below

Q: Using the first and second base key below, predict the DNA sequence given by the SOLID color…

A: Answer:- Nitrogenous bases are crucial components of nucleotides, which are the building blocks of…

Q: How would I solve this? primer (5’ TCAAAACG 3’ ) is shown hybridized to its template DNA below.…

A: The question inquires about the Sanger sequencing method, a strategy utilized to decide the grouping…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: A team of scientist is interested in the amplification of a specific DNA fragment in a large plasmid…

A: The specific DNA sequence can be amplified by using primers in the polymerase chain reaction or PCR.…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: Below is a portion of an exon from a gene that encodes protein Y in the genome of the plant…

A: Ans 1 :  Yes, there is a mutation in third codon when counting from 5/ to 3/ on template strand in…

Q: EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments…

A: A restriction site or recognition site, is a specific sequence of nucleotides in DNA that a…

Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…

A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…

Q: What restriction enzyme (or enzymes) would you use to cut the following...   (Gene of Interest is…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: The DNA of a deletion of alpha bacteriophage has a length of 15 micrometers instead of 17…

A: The bacteriophage is those viruses that have the capability to infect bacteria and reproduce inside…

Q: What is the DNA template of the following DNA coding:  ATGGCTAACCTTGTA

A: The DNA template strand is a complementary strand to the DNA coding (sense) strand. It serves as a…

Q: Given the Following DNA template, TAC   CGC   TCC   GCC  GTC   GAC   AAT   ACC   ACT, write out the…

A: The DNA template is used for the synthesis of mRNA molecules. mRNA molecule is used by the…

Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…

A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: A 13-nucleotide section of an autoradiogram from a Sanger sequencing experiment is depicted in the…

A: The DNA is made up of nucleotides that contain nitrogenous bases, pentose sugar and phosphate group.…

Q: The sequence of the transcript is 5'-GGUUACAUUC-3'. The sequence of the DNA template would be:…

A: Transcription is a biological process that occurs in the cells of living organisms, where genetic…

Q: Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the…

A: Restriction endonucleases cut double stranded DNA at specific site or near specific site and form…

Q: Suppose you have to design two PCR primers, 16 bases in length, to amplify the whole of the 100 bp…

A: Primers are short nucleic acid molecule, that are single stranded in nature and area prerequisite…

Q: 5'-GATTACAATAGGAATTC~~ GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~ CTTAAGAGCACTGAGGC-5' Which of the…

A: PCR or polymerase chain reaction is a DNA amplifying technique where a short piece of a gene or a…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…

Q: How many base substitutions are there between these sequences? Count ONLY the instances where there…

A: Sequence alignment involves the comparison of sequences of a particular gene from various organisms…

Q: TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense…

A: ORIGINAL:- TGAGGATGAAACTCACACCGGGGCGCAAGTTTGGCACTTAGATTCTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: For the DNA sequence shown, indicate the products of its cleavage with the following restriction…

A: In the field of molecular biology and genetic engineering, restriction enzymes, commonly referred to…

Q: Primers designing for epitope tagging: Design forward and reverse primers to amplify the following…

A: Primers should generally have the following properties: 1. Length of 18-24 bases. 2. 40-60% G/C…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.