Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3'

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: 5’-GTCGTATAGTGA-3’ 3’-CAGCATATCACT-5’ What does the newly formed RNA sequence look like if the RNA…

A: DNA forms a double-helix in which two antiparallel strands are wound around each other. The two…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: DNA stands for deoxyribonucleic acid and is found in the nucleus of eukaryotic cells and in the…

Q: The template strand (notice the directionality) of DNA that is known to encode the N-terminal region…

A: The biochemical material that is transferred from the preceding generation to the succeeding…

Q: 5' AU Py U A AGGCC G. UGGC G C G GGG What modified nucleoside base is indicated by the arrow?…

A: The answer of the above question is : Pseudouracil (Ψ). Pseudouridine (psi- Ψ)is an isomer of the…

Q: Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna…

A: In molecular biology, the process of protein synthesis involves the conversion of genetic…

Q: A 5' 3' 3' 5' 12. Using the image above, match the red letters with the following: leading strand,…

A: The given image is the replica of the 'Replication fork' , part of the DNA which go through the…

Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: The coding strand has the following sequence. Please answer the questions below with regard to this…

A: The coding strands run in 3' to 5' direction and has codons it is transcribed as it is in the mRNA…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The DNA in the coding strand below contains a short imaginary sequence for a short protein in…

A: DNA sequence: 5'-ATGTACCTCGACGATCAAGGCAA-3'1. m RNA sequence:Due to complementary base pairing rules…

Q: Design primers that will amplify the following region of DNA (assume this is one strand from a…

A: The forward primer is designed to anneal to the template DNA strand at the 5' end of the target…

Q: ginine rine ginine cine Third letter DCAG UCAG UCAG

A: There are 64 possible codon out of which 3 codon do not code for any amino acid.  Thus 61 codon code…

Q: The DNA molecule shown below is thought to contain the genetic code for part of an enzyme that…

A: DNA is replicated to form new copies of DNA molecules that further are transcribed into mRNA. An…

Q: Label the 5'  and 3' end of each nucleotide and approximate where the start point (+1) would be on…

A: The process shown here is called transcription.  In this process a molecule of mRNA is synthesized…

Q: The sequence below is a template strand sequence for a gene (a very short one!). Identify the start…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…

A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…

Q: DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: What is the sequence of amino acids from this piece of DNA? 3' CGTACCGGCGGCGGATTA 5'

A: Central dogma is heterocatalytic poses, in which DNA is transcribed into mRNA, and then mRNA is…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-TTAGGAG-3'

A: DNA strands are boned together with the help of hydrogen bonds present between the base pairs. These…

Q: I have a question I'm not sure about here it is...... If a short sequence of DNA is…

A: The Correct option is 2.DNA (deoxyribonucleic acid) is a double stranded molecule in which the two…

Q: Draw the following structure. 1)A single strand of DNA with the sequence 5' GCAT 3'

A: Sure, here's a simple representation of a single strand of DNA with the sequence 5' GCAT 3':   5'  G…

Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…

A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…

Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…

A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…

Q: Use the genetic code table to determine the amino acid sequence of the given message strand of DNA…

A: Proteins are made up of amino acids, which are a type of molecule. The basic components of life are…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the…

A: Deoxyribose nucleic acid (DNA) is the genetic material composed of four nucleotide bases, namely…

Q: 9. Create a matching (complementary) DNA sequence for the following strand: A A A A A C CGA CCGATC

A: DNA is known to be the largest biomolecule in the cell. It is composed of two polynucleotide chains…

Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.