using the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence  5’-TAT-GGC-ATG-3’?       Ile-Arg-Pro     His-Ala-Ile     Tyr-Gly-Met     Val-Arg-Tyr     Ile-Pro-Tyr

Q: A peptide has the sequence sequences in the coding strand of the DNA could code for this peptide?…

A: Genes are hereditary structure which helps in transfer of genetic information. It is important for…

Q: Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 :…

A: The central dogma of molecular biology is that the DNA first undergoes replication to make a copy of…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?

A: The set of "rules" that a cell uses to decipher the nucleotide sequence contained in an mRNA…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: Given several unknown solutions, you are asked to use your knowledge of nutrient tests to identify…

A: Note- according to our guild line we are supposed to answer only one question. Please repost the…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: DNA TAC-TAA-AGG-GAA-GAC-GAG-ATC mRNA AA

A: DNA synthesis or DNA Replication-It is the process by which a cell duplicates its genome(DNA)…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: The base sequence of one DNA strand is given. Use base pairing rules to give the other DNA strand.…

A: The base pairing rules are: G is replaced by C C is replaced by G A is replaced by T and T is…

Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…

Q: Give typing answer with explanation and conclusion  Which of the triplets below is a possible…

A: Production of protein from the mRNA is known as translation in which tRNA is responsible for…

Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…

A: When DNA is converted into RNA then this is called transcription.  When mRNA encodes protein then…

Q: Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile…

A: The central dogma of molecular biology states that it is the unique nucleotide sequence in DNA which…

Q: If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA sequence?

A: Question - If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA…

Q: A segment of DNA is shown below. This segment is located in the region of a gene near where…

A: Formation of a hair loop structure at the end of the termination site results in the termination of…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3'…

A: Transcription is the process by which an RNA molecule is synthesized from a DNA template. It is a…

Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…

A: In order for a gene to be converted into a functional protein, two processes must take place namely…

Q: A segment of DNA has the sequence ATGCCT. What will be the sequence for the transcripted segment? O…

A: Transcription is the cycle by which the data in a strand of DNA is replicated into another particle…

Q: ALL GROUPS HAVE A MUTATION MAKE SURE TO IDENTIFY THEM**

A: A mutation is a change in a DNA sequence. It can result from DNA copying errors made during cell…

Q: the following segment of DNA codes a protien. 5' - TGATGATATTCCAgaargGATG AGCaataGCACATTGATA-3

A: Post-transcriptional modification of m RNA involves the removal of all the introns and linking up of…

Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:…

A: Introduction: A number of enzymes catalyze the breakdown of peptide bonds at a specific site in an…

Q: Assume that you are a RNA polymerase. Which strand is the template strand?…

A: Second one is the template strand for RNA polymerase.

Q: LEU VAL HIS VAL Write the nucleotide sequence of the template strand that corresponds to these…

A: Transcription  Synthesis of mRNA from DNA  Translation Converting genetic information into…

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.