using the genetic code provided what would be the corresponding polypeptide sequence for the DNA template sequence  5’-TAT-GGC-ATG-3’?       Ile-Arg-Pro     His-Ala-Ile     Tyr-Gly-Met     Val-Arg-Tyr     Ile-Pro-Tyr

Q: A peptide has the sequence sequences in the coding strand of the DNA could code for this peptide?…

A: Genes are hereditary structure which helps in transfer of genetic information. It is important for…

Q: Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 :…

A: The central dogma of molecular biology is that the DNA first undergoes replication to make a copy of…

Q: Given the amino acid chain below, get the (a) translation strand, (b) transcription strand strand,…

A: DNA is double stranded. There one strand is the template strand and the other is non-template. From…

Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…

A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…

Q: What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: DNA MRNA Amino Acid

A: It is on the basis of centra Dogma of molecular Biology. central dogma is the process by which DNA…

Q: UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?

A: The set of "rules" that a cell uses to decipher the nucleotide sequence contained in an mRNA…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: Given several unknown solutions, you are asked to use your knowledge of nutrient tests to identify…

A: Note- according to our guild line we are supposed to answer only one question. Please repost the…

Q: Supply the missing information DNA: 3' mRNA: anticodon: amino acids: TAC-CCG-TCG-GGG-CGT-ATA-ACT 5'…

A: Transcription is the process of synthesis of mRNA using one of the strands of the DNA. During this,…

Q: Label the N-terminal and the C-terminal in the above peptide.

A: The amino acid residue on one end of a peptide molecule does have an amine group on the alpha…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: Transcription is the process by which RNA polymerase read out DNA and make m-RNA then mRNA is…

Q: DNA TAC-TAA-AGG-GAA-GAC-GAG-ATC mRNA AA

A: DNA synthesis or DNA Replication-It is the process by which a cell duplicates its genome(DNA)…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: Given DNA strand: 5'  T G T T A G T C G A A T  3'   Write its complementary DNA and its mRNA.

A: The DNA or deoxyribonucleic acid is the double standard helical macromolecule. It is the genetic…

Q: The base sequence of one DNA strand is given. Use base pairing rules to give the other DNA strand.…

A: The base pairing rules are: G is replaced by C C is replaced by G A is replaced by T and T is…

Q: The 20 different amino acids in the protein are normally coded by ------ nucleotides. * 60 61 62 63

A: Nucleotides are building blocks of nucleic acids. Three mRNA nucleotides present together are known…

Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGELLGTATAL -5…

A: DNA replication :-  It is the formation of a new DNA from a pre existing DNA.  The DNA so formed is…

Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…

Q: Give typing answer with explanation and conclusion  Which of the triplets below is a possible…

A: Production of protein from the mRNA is known as translation in which tRNA is responsible for…

Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…

A: When DNA is converted into RNA then this is called transcription.  When mRNA encodes protein then…

Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…

A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets.  The alpha…

Q: Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile…

A: The central dogma of molecular biology states that it is the unique nucleotide sequence in DNA which…

Q: If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA sequence?

A: Question - If the anticodon of a molecule of tRNA has the sequence GAU, what was the original DNA…

Q: A segment of DNA is shown below. This segment is located in the region of a gene near where…

A: Formation of a hair loop structure at the end of the termination site results in the termination of…

Q: Transcript the template DNA (write in mRNA codons) *

A: The synthesis of messenger RNA with the help of DNA is called transcription. The main enzyme of…

Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE

A: Above table is codon anti-codon table for translation of DNA code into protein sequence.

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Which is the DNA template given if the MRNA is 3- CGGAUGCCCGUAUAC -5 ? O 3- GCCTACGGGCATATG-5 O 5-…

A: The common rule of Base pairing in DNA is: A pairs with T by a double bond and G pairs with C by a…

Q: What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3'…

A: Transcription is the process by which an RNA molecule is synthesized from a DNA template. It is a…

Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…

A: In order for a gene to be converted into a functional protein, two processes must take place namely…

Q: A segment of DNA has the sequence ATGCCT. What will be the sequence for the transcripted segment? O…

A: Transcription is the cycle by which the data in a strand of DNA is replicated into another particle…

Q: ALL GROUPS HAVE A MUTATION MAKE SURE TO IDENTIFY THEM**

A: A mutation is a change in a DNA sequence. It can result from DNA copying errors made during cell…

Q: the following segment of DNA codes a protien. 5' - TGATGATATTCCAgaargGATG AGCaataGCACATTGATA-3

A: Post-transcriptional modification of m RNA involves the removal of all the introns and linking up of…

Q: What type of mutation is shown in the diagram?   Why do you think this type of mutation is referred…

A: Mutations are alterations in the gene sequence due to presence or interference of certain mutagenic…

Q: A polypeptide is digested with trypsin, and the resulting segments are sequenced:…

A: Introduction: A number of enzymes catalyze the breakdown of peptide bonds at a specific site in an…

Q: Assume that you are a RNA polymerase. Which strand is the template strand?…

A: Second one is the template strand for RNA polymerase.

Q: What is the protein product of the following DNA sequence? 5'-AACTCCGACTACGCTCCATTTCGAGCA-3'…

A: Proteins are complex biomolecules made up of chains of amino acids that fold into specific…

Q: LEU VAL HIS VAL Write the nucleotide sequence of the template strand that corresponds to these…

A: Transcription  Synthesis of mRNA from DNA  Translation Converting genetic information into…

Q: Below is a schematic of the molecule that inserts the fourth amino acid (a trytophan) into the…

A: tRNA is a transfer Ribonucleic acid molecule that helps decode the mRNA sequence to convert it into…

Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?

A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.