A segment of DNA is shown below. This segment is located in the region of a gene near where termination of transcription occurs. Type one of the sequences in the DNA template strand that corresponds to the inverted repeat that can lead to an mRNA hairpin loop. 5' CCGATACCCTCGTTTTCGAGGGTATTTTTT 3' GGCTATGGGAGCAAAAGCTCCCATAAAAAA 3' 3' 5'
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Give typing answer with explanation and conclusion
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
