What kind of mutation is present in the following DNA strand?: Wild-type: 3'-AGTCCCTGAAAT-5' Mutant:     3'-AGTCCCTGCAAT-5' Use the codon table if you need it. Answer choices: Deletion, Insertion, Missence, Silent

Q: please solve this with step-by-step calculations and explanations.

A: The following is a step-by-step solution to this problem:a. In order to determine the melting…

Q: Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?   AccI GT^CGAC…

A: Restriction enzymes are the specific enzymes that recognize and cut at specific sites on nucleotide…

Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…

A: Introduction  Deoxyribonucleic acid is a polymer made of two polynucleotide chains that coil around…

Q: For the following sequence design the forward and reverse primer... explain and justify your answer.…

A: A primer is a short, single-stranded DNA or RNA sequence that initiates DNA synthesis. In PCR,…

Q: che wild type DNA sequence reads THE CAT ATE THE BIG RAT, what type of mutation would change the…

A: Any heritable permanent change in the DNA (deoxyribonucleic acid) sequence is referred to as a…

Q: Like many biotechnologies, CRISPR/Cas9 was originally discovered as system that naturally occurs in…

A: Biotechnology is the branch of biology which deals with the utilisation of cells and biomolecular…

Q: The given DNA non-template sequence (coding sequence) is transcribed from 5' to 3'. Use the sequence…

A: DNA or deoxyribonucleic acid serves as the hereditary material of biological entities. It is…

Q: Place the steps necessary to perform RNA-Seq in the correct order. Drag the text blocks below into…

A: RNA sequencing, or RNA-Seq, is a powerful tool for analyzing the transcriptome of cells or tissues,…

Q: a b Select one or more answers and submit. For keyboard navigation... SHOW MORE ✓ Transcription…

A: Introduction :- The process of transcribing a piece of DNA into RNA is known as transcription.…

Q: Based on the sequence data in the figure above, would you consider the patient to be not affected,…

A: Based on the information provided in the figure above, it can be concluded that the patient is…

Q: design a method to treat the most common mutation that causes sickle cell anemia using CRISPR/Cas.…

A: CRISPR Technology/  Clustered regularly  interspersed  short palindromic repeats is the technology…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: please help

A: To interpret the sequencing gel: 1. Identify the Bands:  - Each lane represents where synthesis is…

Q: C RNA 5' UGGU I III II ACCAT CAGTC A G II TEMPLATE DNA 5' RNA polymerase

A: Transcription: Formation of mRNA from DNA with the help of enzyme RNA polymerase.

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: The following statements are either accurate as written or contain some errors. You need to rewrite…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to…

A: Answer: REPLICATION of DNA : It is the process in molecular biology where  DNA strands are used to…

Q: Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this…

A: A codon is a three-nucleotide sequence of DNA or RNA that corresponds to a specific amino acid or…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: Following the spill of a mixture of chemicals into a small pond, bacteria from the pond are tested…

A: When a chemical spill occurs, particularly in a biologically dynamic environment like a pond, the…

Q: These are written as either accurate or contain errors. Rewrite each one with an error as an…

A: The mutations in the genome are the source of the genetic variations in a population. The changes in…

Q: A certain section of the coding (sense) strand of some DNA looks like this: SATGTATATCTCCAGTTAG-3…

A: Alternation of DNA sequence or any other charge in the chromosome shape or number is considered as a…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…

Q: For each of the following sequences, place a check mark in the appropriate space to indicate the…

A: DNA replication is the process by which a single DNA strand will produce two identical daughter…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.