If the sequence of DNA on the template strand of a gene is AAA, the mRNA codon produced by transcription will be and will specify the amino acid A. UUU, phenylalanine B. AAA, phenylalanine C. AAA, lysine D. TTT, arginine In the given anticodon CCA - UAU - UCG, what is the resulting amino acid sequence? A. glycine-isoleucine-serine B. histidine-serine - tyrosine C. proline - tyrosine - tyrosine D. proline - isoleucine - serine

Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…

A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…

Q: During the termination of translation, what is the correct polypeptide sequence which will be…

A: DNA is the storehouse of genetic information. This information age expect by the formation of an…

Q: A) Draw the mRNA to be translated if the pre-mRNA is constitutively spliced. [ 3) Draw an mRNA to be…

A:

Q: Transcription factors usually contain one or more motifs that play key roles in their function. What…

A: A transcription factor is a sequence specific DNA-binding factor and upon binding to the DNA…

Q: A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT…

A: Introduction  A mutation is a change in the DNA sequence that may occur due to incorrect…

Q: Degeneracy of the genetic code denotes the existence of which of the following? A. codons that can…

A: Characteristic of genetic code: - The genetic code is a triplet (first suggested by Gamow in 1954).…

Q: which signal serves a similar function as the Shine-Dalgarno Sequence in prokaryotes?   A. The…

A: The Shine–Dalgarno sequence is a ribosomal binding site in prokaryotic mRNA, generally located…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: Explain the meaning of the name reverse transcriptase.

A: Reverse transcriptase as the term suggests is an enzyme that functions to synthesize DNA from the…

Q: The sequence of bases in a sample of MRNA was found to be: GGU,AAU,CCU,UU0,GUU,ACU,CAU,UGU a Deduce…

A: mRNA is messenger RNA which is produced as a result of transcription from DNA. RNA polymerase…

Q: An anticodon would be found on which of the following types of RNA? a. snRNA (small nuclear RNA)…

A: Ribonucleic acid (RNA) is a vital biological macromolecule that persists in all biological cells…

Q: Select the description of an intron. (If possible, please explain why it is that answer)  a.)…

A: Pre-mRNA contains both introns and exons in it's sequence. This pre-mRNA then undergoes modification…

Q: The template strand of a segment of double-helical DNA contains the sequence –…

A: Introduction: DNA is a type of nucleic acid present in the nucleus of the cell. It is the genetic…

Q: Look carefully at the illustrations for gene translation. What mRNA codon specifies the tRNA…

A: As the illustration for the gene translation is not given. we are providing all the possible codons.

Q: 1. The following is showing the process of translation with MRNA, TRNA and a ribosome. a) Label the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Consider the following segment of a template strand of DNA: Part A -АТА AGC TTC GAC What is the MRNA…

A: Transcription is the process of making an RNA copy of a gene sequence known as mRNA by using DNA as…

Q: A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce…

A:

Q: You are studying a eukaryotic gene in which translation normally begins at the second AUG in the…

A: Self-explanatoryPlease give me a helpful rating if you are satisfied with my answer

Q: Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the…

A: DNA contains the genetic information for the physical characteristics of the human body. The DNA…

Q: Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the…

A: Genetic code is a triplet code called a codon. There are 64 codon out of which three codon do not…

Q: A segment of template DNA is known to contain the following base sequence: 3'…

A: The DNA sequence given above is a template for transcription, which is the process by which mRNA…

Q: 43. What did the Meselson-Stahl experiment demonstrate? A. The conservative mechanism of DNA…

A: What does meselson and Stahl experiment demonstrate? Meselson and Stahl experimented using E. coli…

Q: A series of tRNAs have the following anticodons. give all possible codons with which each tRNA can…

A: Anticodon relatable term with another term which is codon. A codon is a three-nucleotide stretch of…

Q: Question 2 coding strand is: 5'-TACGATCATAT-3’. This sequence is transcribed. What is the sequence…

A: During transcription only one strand of the transcription unit is transcribed. Transcript is…

Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.