Consider the following segment of a template strand of DNA: Part A -АТА AGC TTC GAC What is the MRNA produced for the segment? -UAU-UCG-AAG-CUC- Part B Complete previous part(s) Part C What is the MRNA if a mutation changes AGC to AAC? Part D Complete previous part(s) Part E What is the MRNA produced if G is inserted at the beginning of the DNA segment?

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…

A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Indicate which of the following items are associated with transcription or translation.  This could…

A:

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A:

Q: 5’-TAATTCTATGATATTAATATC -3’     mRNA sequence:     protein sequence:

A: The process of transcription of DNA to RNA and the RNA to protien  is based on complimantry DNA…

Q: DNA TAC-TAA-AGG-GAA-GAC-GAG-ATC mRNA AA

A: DNA synthesis or DNA Replication-It is the process by which a cell duplicates its genome(DNA)…

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: a) Two of the following three mRNA sequences code for the same protein.  Delete the sequence which…

A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…

Q: Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’…

A: Gene is the basic unit of heredity. All living organisms contain nucleic acid in their nucleus as…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which the mRNA, transcribed from the template strand of the…

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: Which is the coding strand? Which is the template strand? What is the direction of mRNA…

A: The process of synthesizing a messenger RNA (mRNA) molecule from a DNA template is known as mRNA…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…

Q: if the following DNA sequence were transcribed, which of the following describes the output of this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3'…

A: Transcription is the process by which an RNA molecule is synthesized from a DNA template. It is a…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: A strand of DNA, TACGCT, serves as a template for mRNA transcription. What would be the correct…

A:

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.