Consider the following segment of a template strand of DNA: Part A -АТА AGC TTC GAC What is the MRNA produced for the segment? -UAU-UCG-AAG-CUC- Part B Complete previous part(s) Part C What is the MRNA if a mutation changes AGC to AAC? Part D Complete previous part(s) Part E What is the MRNA produced if G is inserted at the beginning of the DNA segment?

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…

Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…

A: A mutation is a change in a DNA sequence.

Q: Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases…

A: In eukaryotic organisms, the gene contains introns as well as exons.  Eukaryotic genomes are much…

Q: you are given a printout of the sense strand of your DNA.  The printout is shown below. The first…

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base…

Q: A certain template DNA strand has the following nucleotide sequence:…

A: DNA is doubled stranded and has two strands - a template and a coding strand. Here, given a template…

Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…

A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: 5’-TAATTCTATGATATTAATATC -3’     mRNA sequence:     protein sequence:

A: The process of transcription of DNA to RNA and the RNA to protien  is based on complimantry DNA…

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: a) Two of the following three mRNA sequences code for the same protein.  Delete the sequence which…

A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which the mRNA, transcribed from the template strand of the…

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: Which is the coding strand? Which is the template strand? What is the direction of mRNA…

A: The process of synthesizing a messenger RNA (mRNA) molecule from a DNA template is known as mRNA…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…

A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: The coding strand of DNA in a segment of a gene is as follows: ATG GGC CTT AGC. This strand carries…

A: The DNA (deoxyribonucleic acid) duplex consists of a non-template and a template strand. The…

Q: if the following DNA sequence were transcribed, which of the following describes the output of this…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: What is the base sequence of a mRNA strand that is complementary to the DNA sequence 5'-ATCGGATTC-3'…

A: Transcription is the process by which an RNA molecule is synthesized from a DNA template. It is a…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: Proteins are defined as polymers of amino acids. As there are 22 standard alpha-amino acids by which…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: Alternative splicing is a process that enables a messenger RNA to direct the synthesis of different…

Q: a. What polypeptide is coded for by the mRNA sequence: 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'? N-terminus -…

A: A sequence of three consecutive nucleotides in messenger RNA (mRNA) coding for amino acids is…

Q: For the following DNA sequence: 3-CGATACGGCTATGCCGGCATT-5' The the sequence of the complementary DNA…

A: Complimentary base pairing Base pairing take place between a purine and pyrimidine. In DNA, adenine…

Q: Which of the following sites would you predict to be present in the gene encoding a MRNA molecule…

A: mRNA known as messenger RNA carries the genetic information that is copied from DNA. mRNA contains…

Q: Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak…

A: The eukaryotic RNA is formed from the eukaryotic DNA by the process of transcription.

Q: Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA Which…

A: According to the central dogma of life, DNA replicates to form copies of itself. DNA acts as a…

Q: What happens when one base pair of DNA is lost from the coding region of a gene because of mutation?…

A: This type of mutation is known as Deletion mutation in which a single or entire sequence of…

Q: Match the term with its definition comparing genomic DNA, mRNA, and proteins. You may only use each…

A: Genes are hereditary units on DNA (Deoxyribonucleic acid) that control specific characteristics of…

Q: 5' - ATG CGA TTT GGG TGC TAG - 3'

A: Refer to the DNA template strand below. Which of the following corresponds to the protein coding…

Q: Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents…

A: Chemically, chloramphenicol is a simple structure made up of nitrobenzene ring bonded with non-ionic…

Q: A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this…

A: During transcription, DNA information is transcribed into messenger RNA, which is then used to…

Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…

A: The information from the DNA is transferred to RNA by transcription. The information present in the…

Q: The following mRNA is found inside a yeast cell:  5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ Write the…

A: Given mRNA strand:  5’ ACUAUGCGAGAAAGCAACUACGCCUAA 3’ mRNA is formed by transcription from a DNA…

Q: The following DNA sequence occurs as the template strand:   3’ – TACGGGGATCAGATTATC – 5’ DNA…

A: CENTRAL DOGMA-  Replication is the process when DNA replicates itself means it will make copies of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.