a) Two of the following three mRNA sequences code for the same protein.  Delete the sequence which does NOT code for the same protein as the other two.  [  /1]   #1  UUU CCU AGU GGU #2  UUC CCA AGC GGC #3  UUC CCG AGA GGA   b) Despite the fact that one of the mRNA sequences above codes for a different protein, it IS possible that it will be translated into the same protein as the other two.  Based on what you have learned in this unit, explain how this might happen.

Q: al mRNA: 5’- AUG GGC UCG ACC UUG -3’ Mutant mRNA 1: 5’- AUG GGC UAG ACC UUG -3’ Mutant mRNA 2: 5’-…

A: The physical and functional unit of heredity is the gene. They pass on knowledge from one generation…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The following double stranded segment of DNA is part of a protein coding gene. The segments in…

A:

Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…

A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: The knowledge included in the mRNA, which is created by replicating DNA, instructs the cell on the…

Q: Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To…

A: Molecular Biology is the branch of biology that deals with a study of the composition, arrangement,…

Q: DNA mRNA Amino Acid DNA mRNA Amino Acid DNA mRNA Amino Acid DNA mRNA Amino Acid CAA 105 CCG 154 AAG…

A: In case of DNA 4 bases are A,T,G,CIn case of RNA during transcription these transcribe same as the…

Q: Given the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA…

A: In the process of protein synthesis, DNA is transcribed into mRNA. Complementary base pairing rules…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: The figure below shows the introns and exons found in gene X. The size of each exon and intron is…

A: In genes  there are two type of sequence in eukaryotic organisms. one is responsible for formation…

Q: Eukaryotic mRNAS have a 5' end while prokaryotic mRNAs do not. O IV.

A: Ans- D Explanation- Eukaryoticic and prokaryotic mRNA are two different mRNAs. Prokaryotic mRNA is…

Q: The following sequence is from a region of the M13 bacteriophage genome. Identify and label the…

A: Viruses do not have a living cell like other organisms. They have genetic material encapsulated…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Write down the complementary mRNA sequence for each of the following DNA sequence. A:…

A: If template sequence of the DNA is A..   mRNA is .. AUGGAUCGCGUGUACAUCCACCCGUUUCAA

Q: a) Indicate the chronological order the following RNA processing events by indicating a number (from…

A: Step 1 Here's the chronological order of the pre-mRNA processing events: Pre-mRNA processing…

Q: There is a situation in which a gene has five exons. Please draw four possible mature products of…

A: Alternative splicing is a biological process that involves the joining of exons from the same gene…

Q: Given the following DNA sequence from the template strand of a given gene:…

A: Codon is a  sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…

Q: We have a eukaryotic full-length mRNA molecule consisting of 33 bp 5ʹ -...…

A: The mRNA (messenger ribonucleic acid) is a messenger molecule produced through the process of…

Q: The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'

A: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3'   As following the rules in Genetic code the…

Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…

A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…

Q: b) In eukaryotes, the newly synthesized mRNA undergoes modifications before it is transported across…

A: In eukaryotic cells, transcription is a process in which genetic information in the DNA is converted…

Q: Given the following MRNA sequence, what is the amino acid sequence of the polypeptide that will be…

A: The mRNA is read in the 5' to 3' direction by the transcription machinery to produce the polypeptide…

Q: In eukaryotes there is not a consistent relationship between the length of the coding sequence of a…

A: DNA is 2.2 m long molecule in human beings.  It is converted to mRNA via process of transcription.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.