The following RNA: 5 AUGAUAACACUCGUACCUUAAUGUS' in the 5'-3'frame will betranslated into a peptide (use the table) Second letter U A G UUU Phe UCU UAU Tyr UGU Cys UUC (F) U UUA Leu UCA (S) UGC (C) C UGA Stop A UC Ser UAC (Y) UAA Stop UUG (L) UCG UAG Stop UGG Trp (W) G CUU CAU His CGU CCU CCC Pro CUA (L) CCA (P) САС (Н) САА Gln CUC CGC Leu Arg CGA (R) CUG CCG CAG (Q) CGG AUU ACU AAU Asn AGU Ser AUC Ile (1) AUA ACC AAC (N) AGC (S) Thr ACA (T) AAA Lys AGA Arg AUG Met ACG (M) AAG (K) AGG (R) G GUU GCU GAU Asp GAC (D) GGU GUC Val G GUA (V) GCA (A) GGC Gly (G) GCC Ala GAA Glu GGA GUG GCG GAG (E) GGG G TLRECYH OA MITLVP Stop C OR OCKVRLS MITLVP OD. First letter C. Third letter

Q: 3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’…

A: 5' cap  help in translation and prevent degradation of m- RNA  and poly A tail help on initiation of…

Q: 5' AU Py U A AGGCC G. UGGC G C G GGG What modified nucleoside base is indicated by the arrow?…

A: The answer of the above question is : Pseudouracil (Ψ). Pseudouridine (psi- Ψ)is an isomer of the…

Q: Determining the amino acid sequence in a protein usually in- volves treating the protein with…

A: Treatment of a polypeptide with eleven amino acids with one reagent gives the following fragments :…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC   By in vitro translating the mRNA, you…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: the mRNA and DNA used to synthesize the polypeptide sequence shown and the nucleotides of the tRNA…

A: DNA has two strands. One is called template strand and other is called coding strand. These two…

Q: Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase III III E - A compound with no electrical…

A: Chaperones are proteins that aid in the folding, assembly, and stabilisation of other proteins in…

Q: Write the corresponding section of a mRNA produced from each of the following DNA sections: a. DNA:…

A: DNA is a polymer made up of two chains of polynucleotides that twist around one another to create a…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: What is it? tRNA Met 0- ✓ Formylmethionine Met-tRNA O- Aminoacyl-tRNA L-histidine Methionine H₂ NH₂…

A: Transfer RNA serves as a physical connection between the amino acid sequences of mRNA and…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: How many different polypeptides would you expect to see synthesized by an in vitro translation…

A: The mRNA is a sequence of ribonucleotides that contains three possible reading frames. Only one…

Q: 14.18) Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to…

A: It is important to know how DNA and RNA work together to make proteins. In transcription, DNA helps…

Q: how do you translate this sequence RNA A C U G U C A U G A G C C C U G C A…

A: Translation is the process by which proteins are synthesized by the ribosomes after the process of…

Q: Give the amino acid sequence with some little explanation please.   5′…

A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…

Q: Complete the labels for the following diagram of translation. NOTE: A is the product of this…

A: Translation is the second step of gene expression in which information from mRNA is encoded into the…

Q: For the anticodon sequences  5' IAA, consider the DNA sequence of the gene encoding the tRNA, what…

A: Transfer RNA is a RNA which is used in the protein synthesis or translation process. It carries a…

Q: All tRNA molecules have poly (A) tails at their 3' end. Yes or no

A: Introduction: Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: Use the codon table shown above to help answer this question. An original (wild-type) mRNA sequence…

A: The changes in the nucleotide sequence of DNA or RNA is known as mutation that can alter the…

Q: What would be the tRNA anticodons for the mRNA in question 3

A: Answer- ATGGATCT CGA- UACCUAGA GCT will be the following anti-codons .

Q: 12. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: mRNA codon sequence-: 5'-GGU-ACG-CUA-3' Aminoacids sequence: Gly-Thr-Leu

Q: Which of the peptide sequences below best matches the hydropathy plot shown? 1. ILYYAGSREDHSGYLIL 2.…

A: Based on the hydropathy plot shown, which has regions of both positive and negative values…

Q: Aminoacyl-tRNA synthetases exhibit selectivity which functions to verify that: all class I…

A: mRNA or messenger RNA carries genetic information as nucleotide sequence copied from template DNA…

Q: AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If…

A: Introduction:  Mutations are changes in the genetic material or character of an organism. It can…

Q: Please help me complete this solution, i cant figure out what is incoorect about this statement...…

A: The protein is a principal component of the entire cell. It is an organic compound that is made of…

Q: What are two possible anticodon sequences for RNA's that are charged with Phenylalanine (Phe)? O 3'…

A: According to the question, we have to find out the two possible anticodon sequences for tRNA's that…

Q: tRNA charging produces a functional tRNA with an appropriate O ribose to deoxyribose ratio O lipid…

A: t RNA is transfer RNA which helps in the process of translation which is a part of gene expression.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.