Match the following (Most appropriate combinations only): IF1 IF3 IRES Shine-Dalgarno sequence m7-G Cap aminoacyl tRNA synthetase proofreading elF4E ✓ [Choose ] Binds ribosome A site Translation initiation in eukaryotes Translation initiation in Bacteria binds mRNA cap in eukaryotes Binds ribosome E site Correct charging of a tRNA with amino acid Cap-independent translation initiation of some viral mRNAs [Choose ] [Choose ] [Choose ] [Choose ] >

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: Help me figure out how I should interpret and read these graphs. We are looking to see whether the…

A: The regulation of RNA splicing is a complex process that involves the interaction of multiple…

Q: How many tRNA molecules can associate with a ribosome at any given time during translation

A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: The Cystic Fibrosis receptor (CFTR) is a transmembrane protein that functions as an ion channel…

A: The compartment where Delta 508 mutation occurs that leads to folding defect in CFTR.  This causes a…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: The "factory" itself, made of two [Choose] subunits [Choose] FRNA The site from which the growing…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: To which of the following tRNA structures is the amino acid attached with during aminoacylation?…

A: The production of polypeptide chain from the mRNA (contain genetic codons) is known as translation…

Q: Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase III III E - A compound with no electrical…

A: Chaperones are proteins that aid in the folding, assembly, and stabilisation of other proteins in…

Q: The tRNA molecule carries EIF2 and GTP and binds the small ribosomal subunit at the P site in the…

A: During the process of translation which is the synthesis of proteins from mRNA translation…

Q: EUKARYOTIC RNA POLYMERASES Based on their elution order from ion-exchange chromatography…

A: Eukaryotic RNA polymerase :  In eukaryotic cells we can find three different types of RNA…

Q: ginine rine ginine cine Third letter DCAG UCAG UCAG

A: There are 64 possible codon out of which 3 codon do not code for any amino acid.  Thus 61 codon code…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: During translation elongation cycle, which of the following step(s) is/are repeated for each amino…

A: Translation is a process by which proteins are synthesized from mRNA template. It involves all the…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG…

A: In this image the process of transcription is shown where an mRNA is being translated with the help…

Q: None

A: Thes images is only for reference purposes

Q: Part A Which of the following processes is represented in the figure below? 3' AAG UGA RF1 RF2 O…

A: Thank you for the question  Answer :- The given picture shows translation termination Explanation :-…

Q: The figure provided in in the introduction above shows adenine being deaminated to form the…

A: Wobble hypothesis - is about the base pairing between nitrogen bases in 1st and 2nd positions of the…

Q: Identify one mistake that was introduced in the following figure.  True or false? The first few…

A: Since it is the method through which DNA is utilized as a template to produce RNA, transcription is…

Q: Match the function with the appropriate protein or sequence:

A: tRNA is a short nucleotide chain with L-shaped structure. A tRNA molecule is required for…

Q: For the tRNA below, determine which amino acid it is charged with. attached amino acid DD GA G 5'…

A: Several biological molecules in animals are tiny and simple, with just one or a few functional…

Q: TRUE FALSE EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle…

A: There are many biomolecules present in an organism and each biomolecule has a specific role.…

Q: If the anticodon of an alanyl-tRNA is IGC (inosine-guanine-cytosine), to which of the following…

A: In order to answer this question, we must be familiar with Wobble hypothesis. We know that the mRNA…

Q: None

A: Here is the matching of each aspect of transcription or translation with the appropriate motif,…

Q: Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a…

A: Step 1 Genetic codes are genetic information present in the nucleotide sequences of DNA…

Q: Using the given information, determine the correct order of the following events during translation:

A:

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?

A: A genetic mutation known as a deletion occurs when one or more nucleotides are lost from a DNA…

Q: 21. The processing events that must occur on the MRNA after it is transcribed, but before it is…

A: In eukaryotes, transcription and translation take place in different cellular compartments:…

Q: Do not use Ai

A: source: Internet (to make understand the concept)

Q: a) Indicate the chronological order the following RNA processing events by indicating a number (from…

A: Step 1 Here's the chronological order of the pre-mRNA processing events: Pre-mRNA processing…

Q: For the anticodon sequences  5' IAA, consider the DNA sequence of the gene encoding the tRNA, what…

A: Transfer RNA is a RNA which is used in the protein synthesis or translation process. It carries a…

Q: None

A: Step 1: Understanding the Anticodon and Codon RelationshipAnticodon: The anticodon is a sequence of…

Q: What is the purpose of the underlined sequence?   5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG…

A: In molecular biology, understanding the purpose of specific nucleotide sequences is crucial for…

Q: Explain the interactions of specific tRNA with its synthetase, by including the importance of…

A: Answer) Cloverleaf structure of tRNA: It is formed due to the intramolecular hydrogen bonds and…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.